Выход в трубку озимой пшеницы фото: ФАЗА «КУЩЕНИЕ – ВЫХОД В ТРУБКУ»| Syngenta

Содержание

ФАЗА «КУЩЕНИЕ – ВЫХОД В ТРУБКУ»| Syngenta

Фазы роста и развития ячменя 


Кущение. Что происходит с культурой эту фазу?

Кущение – это появление новых побегов у зерновых за счет подземного ветвления стебля.
Зона кущения является:

  • Важным источником меристаметических тканей для формирования боковых и придаточных корней;
  • Механической основой для надземной части побега;
  • Распределителем воды и минеральных солей, поступающих из корней, и органических соединений, поступающих из листьев;
  • Запасающим резервуаром питательных веществ.

Отмирание узла кущения приводит к гибели.

Как происходит кущение?

Почка, лежащая у основания первого листа, увеличивается, отодвигает лист и формирует первый боковой побег. В дальнейшем в пазухах нижних листьев боковых побегов закладываются новые почки, которые могут давать побеги 2-го, 3-го и большего порядка.

Одновременно с образованием боковых побегов из узла кущения формируется вторичная корневая система. Вторичная корневая система хорошо развивается при наличии почвенной влаги и при наличии доступной формы фосфора. В сухом верхнем слое вторичные стебли и корни не образуются. К концу кущения растения ячменя поглощают около 50% азота и фосфора и 75% калия от общего потребления.

Что влияет на глубину залегания узла кущения?

  • Свет.При недостатке света узел кущения залегает ближе к поверхности.
  • Глубина заделки семян, тип почвы.
  • Температура. При пониженной температуре воздуха узел кущения заглубляется.
  • Сорт.

Во время кущения происходят закладка побегов, колосков и цветочков, а также обильный рост корней.
Кущение – самая УЯЗВИМАЯ СТАДИЯ развития ячменя.

ЧТО МОЖЕТ НАНЕСТИ ВРЕД КУЛЬТУРЕ В ЭТУ ФАЗУ?

В фазу кущения посевам ячменя кроме ранних листовых вредителей, таких как блошка и др. листоеды, большой вред наносят сорняки. Всходы многих сорняков появляются одновременно со всходами ячменя и являются конкурентами за влагу и питательные вещества.

Что может сделать агроном для будущего урожая прямо сейчас?

Подобрать гербициды с учетом видового состава сорняков и степени засоренности.
Химический метод – один из наиболее эффективных. При выборе гербицида для конкретного поля следует учитывать его эффективность к преобладающим там сорнякам. На одно поле может присутствовать более 20 видов сорняков из разных биологических групп. Показателем уровня засоренности следует считать не количество растений сорняков, а их массу на единицу площади. В этом отношении все сорняки условно можно разделить на доминанты, субдоминанты и сопутствующие виды.

Обработку против сорняков нужно проводить до экранирования сорняков культурой, т.е. гербициды должны попасть на целевой объект – сорняки.

При преобладании в посевах таких сорняков как молочай лозный, вьюнок полевой, марь белая и др. рекомендуется применять гормональные гербициды такие как Видмастер, Диален Супер, Линтур, которые содержат 2,4-Д и дикамбу. Действие таких препаратов основано на росторегулирующих функциях. Препарат проникает в сорное растение через листья и корни и распространяется системно по всему растению к точкам роста. В результате воздействия двух действующих веществ нарушается процесс нормального деления клеток, что приводит к деформации и скручиванию стеблей и листьев, а впоследствии к гибели растений.
Препараты, содержащие в своем составе 2,4-Д и дикамбу применяют только в фазу кущения, до выхода в трубку.

Особое внимание необходимо уделять борьбе со злаковыми сорняками, такими как овсюг обыкновенный, щетинники и просовидные. Семена просовидных сорняков и щетинников легко отделяются от ячменя при очистке, тогда как очистить ячмень от овсюга тяжело, для этого необходимы специальные овсюжные триеры.

При смешанном типе засоренности рекомендуется применять баковые смеси противодвуольных и противозлаковых сорняков. Использование баковых смесей дает фермерам возможность сократить расходы, сэкономить время и повысить биологическую и экономическую эффективность применения средств защиты растений (СЗР), удобрений. При смешивании баковых смесей необходимо соблюдать порядок смешивания препаратов, учитывающий их физико-химические свойства.

Выход в трубку. Что происходит с культурой в эту фазу?

Эта фаза активного роста ячменя.

Начало трубкования растений ячменя отмечается когда стеблевой узел прощупывается сквозь влагалище листа на высоте 3-5 см над поверхностью почвы. Нижние междоузлия раздвигаются и стебель начинает удлиняться. Рост стебля начинается с удлинения нижнего междоузлия. Рост междоузлий заканчивается к концу цветения – началу налива.
Фаза выхода в трубку длится в среднем 15-25 дней.
В этой фазе ячмень очень чувствителен к недостатку влаги, питательных веществ и других факторов жизни. Благоприятная температура в этот период +12-18˚С. К началу фазы трубкования ячмень поглощает до 70% калия, около 45% фосфора и значительную часть азота от общего количества используемого в течение вегетационного периода.
В межфазный период выход в трубку – колошение увеличивается площадь листовой поверхности, растет соломина. В этот период формируются и растет колос.

ЧТО МОЖЕТ НАНЕСТИ ВРЕД КУЛЬТУРЕ В ЭТУ ФАЗУ?
В фазу выхода в трубку посевам пивоваренного ячменя могут нанести вред болезни и вредители. В результате вреда таких вредителей как пшеничный трипс, злаковая тля колос деформируется, образуется белоколосость.

              
      Пшеничный трипс         Желтая ржавчина        Ячменная муха       Полосатая пятнистость 

Засуха в этот период приводит к редукции, т.е. «сбросу» числа побегов и количества зерен в колосе.

Что может сделать агроном для будущего урожая прямо сейчас?

  • Прекратить все гербицидные обработки. В эту фазу закладывается колос и применение повышенных норм гербицидов группы 2,4-Д в этот период может привести к частичной стерильности колоса.
  • Провести инсектицидную обработку против вредителей.
  • Провести профилактическую фунгицидную обработку против листо-стебельных болезней.
  • Провести листовую подкормку удобрениями, содержащими

Фазы роста и этапы органогенеза озимой пшеницы

Особенность озимой пшеницы состоит в том, что при севе ее весной получают хорошие всходы, растения кустятся, но не образовывают стебли и колос. Для нормального роста и развития озимая пшеница должна пройти стадию яровизации при определенной температуре (0-3 °С) в течение 35-60 дней. В процессе развития озимая пшеница «переживает» фазы, которые и определяют количество и качество урожая.

Рост и развитие растений

Озимая пшеница на протяжении вегетационного периода проходит соответствующие фазы развития, связанные с образованием новых органов или их формированием. Прохождение фаз развития, интенсивность роста и продуктивность растений находятся в определенной зависимости от условий существования. Лучше всего растения развиваются при оптимальном обеспечении всем необходимым процессов их жизнедеятельности и качественном выполнении всех агротехнических мероприятий.

В процессе развития озимая пшеница проходит такие основные фазы: всходы, кущение, выход в трубку, колошение, цветение, созревание (молочная, восковая и полная спелость).

Всходы

Наиболее интенсивно семена озимой пшеницы прорастают при температуре 20-25 °С. Всходы при этом появляются через 7-8 дней. Тем не менее оптимальная температура для получения максимального количества всходов значительно меньше, чем для процессов роста, и должна быть в пределах 12-17 °С. Выход первого листка на поверхность почвы характеризует не только фазу всходов, а и переход растения в качественно новое состояние. Если до этого рост корней и зачаточного стебля обеспечивался запасными веществами эндосперма, то с появлением зеленого листка в росте принимают участие пластические вещества, которые образуются в результате фотосинтеза. Продолжительность фазы всходов в нормальных условиях колеблется от 15 до 25 дней.

При поздних сроках сева растения входят в зиму, имея один-три листика. В таком случае фаза всходов продлевается весной при возобновлении вегетации, а ее общая продолжительность вместе с периодом зимнего покоя может составлять 100-150 дней.

Получение высокой полевой всхожести — одна из важнейших задач агротехники, поскольку от нее зависит дальнейший уход за посевами и уровень будущего урожая. При выращивании озимой пшеницы по интенсивной технологии полевая всхожесть должна составлять 8090%, тогда как в хозяйствах, согласно статистическим данным, она не превышает 50-70%, т.е. половина семян не дает всходов.

Кущение

Характерной биологической особенностью хлебных злаков является свойство куститься. Кущение — это появление боковых ростков и узловых корней у растений. Оно наступает после образования 3-4 листьев. Самая оптимальная температура для кущения озимой пшеницы 13-18 °С, а при 2-4 °С кущение почти приостанавливается. Узел кущения является основным органом, при его отмирании растение гибнет. В почве он размещается на глубине 1,5-3,0 см и выдерживает морозы до минус 1720 °С.

В зависимости от срока сева бывает осеннее и весеннее кущение. Число стеблей на одном растении принято называть коэффициентом кущения.

Общее кущение определяют по количеству стеблей на одном растении, а по количеству стеблей, которые дают урожай — продуктивное. Исследование А.И. Носатовского показали, что за два месяца вегетации при теплой погоде и достаточных запасах в почве питательных веществ и воды одно растение может дать до сотни ростков.

В обычных условиях высокие урожаи формируются при продуктивном кущении 2-3 стебля. Коэффициент кущения и необходимую густоту продуктивного стеблестоя (500-700 шт/м2) можно регулировать с помощью агротехники. Заделывание семян на глубину свыше 4 см уменьшает процесс образования ростков. Интенсивность кущения падает при высоких нормах высева, недостаточном обеспечении растений питательными веществами и влагой. Кустистость озимой пшеницы — это также сортовая особенность.

Способность зерновых куститься, нужно рассматривать как положительное свойство. Большая часть сортов формируют 30-50% урожая на боковых стеблях. На изреженных посевах доля боковых продуктивных ростков составляет до 60-70% урожая зерна.

Выход в трубку

Началом фазы считают момент, когда на главном ростке появляется первый стебельный узел на расстоянии 2-5 см от поверхности почвы. Наступает эта фаза через 25-35 дней после возобновления весенней вегетации. Длится 25-30 дней. Холодная и облачная погода замедляет рост стебля.

Во время выхода в трубку интенсивно нарастает вегетативная масса. Формируются генеративные органы. Поэтому в этот период роста пшенице необходим максимум воды и питательных веществ. Недостаток их в почве приводит к значительному снижению урожая.

Установлено, что для получения высокопродуктивных посевов площадь листовой поверхности на 1 га должна составлять 50-60 тыс. м2 и более. Величина листовой поверхности и продолжительность ее фотосинтетической деятельности зависят от удобрения, нормы высева, сорта и других агротехнических мероприятий. Особенно важно обеспечить высокую фотосинтетическую активность верхнего листка, который дает до 70% ассимилянтов.

Колошение

Одновременно с интенсивным ростом стебля, вследствие резкого удлинения предпоследнего междоузлия, происходит выход колоса из влагалища верхнего листка, который означает наступление фазы колошения. Продлевается формирование репродуктивных органов, нарастание вегетативной массы и сухого вещества. Интенсивность процессов роста зависит от обеспеченности влагой и питательными элементами. Это наиболее эффективный период для обработки посевов фунгицидами с целью защиты озимой пшеницы от болезней.

Цветение

При нормальных условиях вегетации через 4-5 дней после выколашивания наступает цветение, которое длится 3-6 дней. Начинается цветение с середины колоса и постепенно переходит к его низу и верхушке. В колоске сначала цветут боковые (нижние) цветки, а затем средние. В первых сроках цветения образуется зерно. Пшеница зачастую самоопыляющаяся культура. На качество зерна сильно влияют метеорологические условия в период от опыления до фазы полной спелости зерна.

Высокая температура воздуха усиливает дыхание растений, способствует чрезмерным затратам углеводов, вследствие чего увеличивается накопление белка в зерне. При более низкой температуре дыхание растений ослабляется, увеличивается накопление углеводов.

Фазы спелости

После цветения и оплодотворения из стенок завязи образуется оболочка зернышка. Рост стебля, листьев и корней почти прекращается и пластические вещества поступают только к зерну. Период формирования зерна длится 12-16 дней и под конец этого периода отмечают наступление молочной

спелости. Зерно в этой фазе уже нормальной величины, но еще зеленое, молокообразной консистенции. Влажность зерна в молочной фазе спелости — 60-40%.

В восковой фазе спелости консистенция зерна напоминает воск, влажность зерна составляет 4020%. В конце этой фазы зерно приобретает нормальную окраску, поступление питательных веществ в зерно и его рост прекращаются. В этот период начинают раздельную уборку.

При полной спелости влажность зерна снижается до 20-14%, оно становится твердым и теряет связь с материнским растением. Собирать озимую пшеницу можно прямым комбайнированием. В случае опоздания с обмолотом наиболее ценное зерно, которое созревает раньше, легко осыпается, что приводит к потерям урожая.

Этапы органогенеза

Фенологические наблюдения фиксируют основные фазы развития пшеницы, тем не менее они не отображают сложных процессов формирования новых органов. Каждый орган, как и растение в целом, проходит несколько этапов во время своего индивидуального развития (органогенеза).

Органогенез — формирование органов растения в их эмбриональном зачаточном состоянии. Ф. М. Куперман выделила 12 этапов органогенеза озимой пшеницы. Зная соответствие фаз развития этапам органогенеза, можно целенаправленно применять агротехнические мероприятия и влиять на необходимый элемент продуктивности — увеличивать количество растений или стеблей на 1 м2, количество зерен в колосе и колоске, массу 1000 зерен, качество зерна и др. (табл. 1, 2).

У растений озимой пшеницы первый этап органогенеза начинается с прорастания семян и заканчивается образованием второго листка. Конус нарастания еще не дифференцирован на отдельные органы. Продолжительность этого этапа — 20-30 дней. Пока растения не завершат стадию яровизации, конус нарастания, как правило, остается в состоянии первого этапа органогенеза. В этот период устанавливается начальная густота растений.

На втором этапе растет конус нарастания за счет вытягивания его верхней части. Отсутствие нормального соотношения важнейших элементов питания приводит к задержке дифференциации конуса на узлы, междоузлия и листья. Рост стебля, его стойкость к полеганию, таким образом, определяются очень рано — условиями роста на втором этапе органогенеза.

На втором этапе из почек развиваются ростки кущения. Происходит развитие узловых (вторичных) корней. В зависимости от сроков сева и метеорологических условий этот этап проходит осенью и частично весной. Продолжительность этапа — 35-40 дней.

Третий этап органогенеза наступает, как правило, в самом начале весенней вегетации. Этот этап характеризуется вытягиванием верхней части конуса, нарастанием и дифференциацией нижнего его участка на отдельные сегменты, зачатки будущих члеников стержня колоса. Чем больше сегментов формируется на III этапе, тем больше может быть члеников колосового стержня, длинным будет колос, больше может образоваться в будущем колосков. Хорошая заправка почвы элементами питания под пахоту и ранневесенняя подкормка азотными удобрениями способствуют увеличению числа члеников, в итоге — колосков в колосе. Длина и продуктивность колоса возрастают также при длительном пребывании растений на этом этапе органогенеза.


Четвертый этап совпадает с началом выхода растений в трубку. Это критический период для озимой пшеницы относительно обеспечения влагой и питательными веществами, которые нужны как для роста вегетативной массы, так и для закладывания колосковых бугорков. От них зависит количество колосков в колосе. Своевременное внесение удобрений почти удваивает зернистость колоса, особенно при умеренной температуре. После прохождения IV этапа увеличить размеры колоса и число колосков в нем уже невозможно. Подкормка обеспечивает также выживание большего количества колосоносных синхронно развитых стеблей.

Пятый этап совпадает по времени с ростом второго междоузлия. Он характеризуется началом формирования цветков в колоске. В колоске может образовываться до 7-9 цветочных бугорков. Первыми начинают дифференцироваться колосковые бугорки в средней части колоса, а затем процесс идет вверх и вниз вдоль оси. Хорошая обеспеченность растений питательными веществами, влагой, световой день продолжительностью не менее 13-15 часов при температуре 1520 °С обеспечивают закладывание большого количества хорошо развитых цветков в колосках и колосе.

По данным Ф.М. Куперман, если при переходе к пятому этапу усилить питание растений, то можно уменьшить разрыв в темпах формирования двух первых и размещенных выше цветков в колосках. Тогда больше цветков в колосе будет образовывать полноценное зерно, увеличится зернистость колоска и колоса. Когда вместо обычных 2-3 цветков будут нормально развиты 4-5 цветков и в них образуются зерновки, то урожайность возрастет вдвое.


Шестой этап проходит у растений, когда они находятся в фазе стеблевания, и совпадает по времени с интенсивным ростом третьего — пятого междоузлий стебля. Он характеризуется формированием пестиков, пыльцевых зерен, зачаточного мешка и столбика рыльца. В этот период особенно важное значение имеют выровненность стеблестоя растений, а также отсутствие сорняков, которые затеняют посевы пшеницы. Фосфорные удобрения, внесенные под пахоту, положительно влияют на формирование генеративных органов еще и на шестом этапе. Заканчивается дифференциация всех частей колоса.

Седьмой этап совпадает с ростом последних междоузлий. Идет интенсивный рост в длину всех органов колоса. В конце этапа колос достигает характерных для сорта размера и формы и содержится во влагалище последнего листка. На этом этапе определяется плотность колоса, которая зависит от метеорологических условий. В годы с большим количеством осадков и облачных дней колос будет более рыхлый, чем в годы с безоблачными днями и дефицитом влаги.

Восьмой этап совпадает с фено-фазой колошения. На этом этапе происходит завершение процессов гаметогенеза и формирования колоса, цветков. Продолжает расти наибольшее верхнее междоузлие.

Своевременная азотная подкормка обеспечивает формирование наполненного зерна с высоким содержанием белка и клейковины.

Девятый этап включает цветение, опыление, оплодотворение, образование зиготы и начало формирования эндосперма. Прекращается нарастание вегетативной массы. Этот этап делит жизнь растения на два периода — вегетативный и репродуктивный.

На десятом этапе формируются зерновки. За счет поступления пластических веществ из листьев и стебля зародыш и эндосперм увеличиваются в размерах. В конце этапа зерно достигает типичных для каждого сорта форм. На следующих этапах длина зерновки уже не увеличивается.

Одиннадцатый этап совпадает с фазой молочной спелости. Идет интенсивное накопление пластических веществ в зерновке. Уменьшается влажность зерна, происходит его рост в толщину и ширину. Хорошая обеспеченность влагой и питательными элементами с невысокой (не более 25 °С) температурой увеличивает массу 1000 зерен и урожайность.

Двенадцатый этап органогенеза по времени совпадает с восковой спелостью зерна. В начале этапа продлевается накопление пластических веществ в зерне, которое постепенно слабеет и полностью прекращается в конце этапа. Зерновка перестает увеличиваться в размере и массе. Питательные вещества зерновки превращаются в запасные.

обратно к списку

Стадии развития зерновых культур (код BBCH)

Bayer

BBCH 09

Всходы: колеоптиль проходит поверхность почвы; лист достигает кончика колеоптиля.

BBCH 10

Первый лист выходит из колеоптиля.

BBCH 11

Стадия первого листа: первый лист развернут; показалось острие второго листа.

BBCH 12

Стадия 2-го листа: 2-й лист развернут; показалось острие 3-го листа.

BBCH 13

Развернуты 3 листа и больше.

BBCH 21

Начало кущения: появляется первый побег кущения.

BBCH 23

Появляется 3-й побег кущения.

BBCH 30

Начало выхода в трубку: главный побег и побеги кущения сильно направлены вверх, начинают тянуться. Расстояние колоса от узла кущения первого см

BBCH 31

Стадия первого узла: первый узел виден на поверхности земли. Расстояние от узла кущения 1 см.

BBCH 32

Стадия 2-го узла: виден 2-й узел. Расстояние от 2-го узла 1 см

BBCH 37

Появление последнего (флагового) листа, еще скроенного

BBCH 39

Стадия лигулы (листового язычка): лигула флагового листа видна, флаговый лист полностью развит.

BBCH 47

Листовое влагалище флагового листа открывается.

BBCH 51

Начало появления соцветия (колошения): видна верхняя часть метелки или колоса.

BBCH 59

Полное появление соцветия: колос или метелка полностью видны.

BBCH 65

Середина цветения: 50% зрелых тычинок

BBCH 73

Ранняя молочная спелость

Рост и развитие пшеницы | Yara Россия

От посева до сбора урожая пшеница проходит три отдельных этапа развития.

Рост и развитие пшеницы

От посева до сбора урожая пшеница проходит три отдельных этапа развития, которые могут быть охарактеризованы следующим образом: 

  • Подготовительная фаза 
  • Фаза формирования 
  • Фаза образования продукта

Подготовительная фаза 

Подготовительная фаза начинается с момента посева и продолжается до начала стадии выхода в трубку. В течение этого периода развиваются продуктивные побеги и первичные корешки, а также начинает формироваться листовой покров. Компоненты урожая (число колосков и зерен на м2) можно установить до окончания подготовительной фазы. Темпы роста зависят от условий окружающей среды. В пасмурные и прохладные дни рост замедляется. При выращивании яровой пшеницы эта фаза завершается быстро, поскольку ее обычно сеют в погожие дни с более высокой температурой воздуха.p>

Фаза формирования 

Фаза формирования начинается с момента образования первого узла и продолжается до цветения. Это самый важный период развития, в течение которого формируются листья, глубинная корневая система и фертильные части цветков, а также накапливаются запасы питательных веществ в стебле. Завершается формирование листового покрова, и теперь он способен улавливать 95% фотосинтетически-активное излучение (ФАР). Темпы роста растений в фазе формирования очень быстрые, поэтому ежедневная потребность в запасах питательных веществ в почве повышена. Эту стадию часто называют фазой активного роста.

Фаза образования продукта 

Фаза образования продукта начинается сразу после цветения и продолжается до налива зерна и его созревание. В течение этого периода определяются основные компоненты урожая, такие как: количество зерна на м2 и вес зерен. Необходимо поддерживать уровень запаса азота и сохранения флагового листа, которые обеспечивают до 70% углеводов, поступающих в зерна. Ниже представлен общий план развития пшеницы (сокращенная версия текста, представленного в справочном руководстве по развитию пшеницы Комитета из зерновых культур Великобритании):

Этапы развития растений пшеницы можно представить более детально с помощью различных систем, принятых к использованию в последние годы. Наиболее широко используются три из них: по шкале Задокса, Фикса и Хауна, причем система Задокса чаще всего применяется при принятии решений по вопросам питания. Ниже представлено подробное описание системы:

Особенности сева озимых зерновых культур в Оренбургской области в условиях 2021 года / Министерство сельского хозяйства, торговли, пищевой и перерабатывающей промышленности Оренбургской области

Рекомендации разработаны учеными Оренбургского государственного аграрного университета. 

Озимая мягкая пшеница – одна из самых ценных и высокоурожайных культур.  Осенний период по зонам области, за исключением Восточной, благоприятно складывается для успешного прохождения закалки её растений к зиме, а мощность снегового покрова, достигающая 35-37 см, оказывается достаточной для ее сохранения. В Восточной зоне часто наблюдается гибель растений озимой мягкой пшеницы, в связи с чем она в данной зоне не высевается.

Озимая пшеница легче, чем яровая, переносит летние засухи, так как в это время у нее уже сформированы репродуктивные органы и, за счет более продолжительного периода вегетации, она значительно полнее яровых культур использует запасы влаги на протяжении года. Высокая эффективность использования осадков озимой пшеницей обусловлена тем, что на начало весенней вегетации она имеет уже хорошо раскустившиеся растения с мощной корневой системой. Высокие потенциальные возможности озимой пшеницы определяются и тем, что у нее осенью происходит подготовительный период перехода верхушечных меристем от вегетативного развития к генеративному, обуславливающий размеры соцветия. В то же время, из-за недостатка влаги и подвижных форм питательных веществ урожаи зерновых культур находятся на уровне 15-25 ц/га. Вследствие этого, для более полной реализации потенциала сельскохозяйственных культур на современном этапе необходимо создание гибких наукоемких технологий возделывания, которые, несомненно, позволят увеличить валовые сборы зерна.

В Оренбургской области озимой пшенице уделяется большое внимание. Для нашего региона, с часто повторяющимися по годам засухами, она является перспективной культурой, посевные площади под которой  постоянно увеличивается.  В перспективе площадь под озимыми культурами будет увеличена до 1 млн. га.

Предшественники, обработка почвы. Предшественник для озимой пшеницы в нашей области – черный пар. Основная обработка почвы зависит от системы удобрения. Если под пар вносятся органические удобрения, то для заделки их в почву используется отвальная вспашка. Если органические удобрения не вносятся, то проводят глубокое рыхление.  Весной – закрытие влаги, с использованием зубовых борон, далее культивации на убывающую глубину по мере отрастания сорняков. При посеве дисковыми сеялками последняя, предпосевная культивация проводится на глубину 6-8 см. При посеве сеялками типа АУП-18 предпосевной культивации не проводят.

Удобрения. Для расчета доз вносимых органических и минеральных удобрений под планируемый урожай на посеве озимой пшеницы используется балансовый метод, с учетом содержания элементов питания в почве и  удобрениях, коэффициентов использования питательных веществ из почвы и удобрений. Вся доза калия вносится под пар, из дозы фосфора часть (10-15 кг д. в.на га) выделяется в припосевное внесение, остальное  — под пар. Азот вносится в составе припосевного удобрения и в подкормки.  Азот и фосфор при посеве можно вносить в виде комплексного удобрения.

Для лучшей перезимовки растений можно проводить осеннюю листовую подкормку в фазу кущения. Такую подкормку проводят препаратами с повышенным содержанием калия, что способствует увеличению накопления сахаров в узле кущения, повышению сопротивляемости к болезням, препятствует перерастанию растений при затяжной и тёплой осени.

Подкормка растений озимой пшеницы должна проводится азотными удобрениями в несколько приемов: ранневесенняя  —  в начале вегетации в разброс  по талой почве или дисковыми сеялками при наступлении физической спелости почвы, некорневое внесение в конце кущения — для увеличения урожайности  и в начале колошения – для  улучшения условий формирования зерна и повышения его качества. Ранневесенняя подкормка позволяет стимулировать ростовые процессы в растениях, быстрее формировать большую площадь фотосинтезирующей листовой поверхности и обеспечить накопление биомассы растений. При ранневесенней подкормке доза азота на озимой пшеницы по пару не должна превышать 40-45 кг/га д.в., вид удобрения, используемый в данный срок — аммиачная селитра. При ранневесенней подкормке можно использовать комплексные удобрения, например аммофос.

Подкормка в конце кущения-начале выхода в трубку положительно влияет на формирование элементов соцветий растений, что обеспечивает увеличение урожая. Без подкормки в начале колошения невозможно получить зерно с высоким содержанием клейковины при хорошем её качестве. Доза азота при некорневом внесении – 30 кг/га действующего вещества, расход рабочей жидкости – 250-300 л/га. Для подкормки используют мочевину или «плав» — смесь, состоящая из 2/3 мочевины и 1/3 аммиачной селитры. Некорневое внесение азота в кущение можно совместить с внесением гербицидов, а в колошение – с обработкой фунгицидами и инсектицидами. В используемые баковые смеси можно добавлять также препараты, содержащие микроэлементы и регуляторы роста, повышающие стрессоустойчивость  растений.

Подготовка к посеву и посев семян. Посев высококачественными семенами для озимой пшеницы является важным фактором получения высокого урожая. Для посева отбирают крупные, выравненные, тяжеловесные семена,  массой 1000 зёрен не менее 40-45  г. Всхожесть их, при этом, должна составлять не менее 92%, сила роста более 80%. Семена перед посевом обеззараживают от возбудителей головневых заболеваний, корневых гнилей, снежной плесени и др.  Протравливание семян совмещают с обработкой микроэлементами и регуляторами роста, что обеспечивает прибавку урожая в 15-20%.

 Для хорошего кущения и укоренения озимых требуется 50-55 дней от посева до прекращения осенней вегетации. Оптимальные сроки сева озимых культур для нашей области – с 10 августа по 5 сентября.

В условиях 2021 года сроки сева озимой пшеницы необходимо сдвинуть – с 20 августа по 10 сентября.

 Рискованно слишком рано сеять озимую пшеницу. Гибель растений озимой пшеницы ранних сроков посева значительнее, чем при оптимальных или несколько поздних сроках посева. Причина этого — в сильном повреждении  шведской мухой и  перерастании растений.

При хорошем увлажнении почвы оптимальные нормы высева озимой пшеницы на черноземах северной и западной зон составляют 5-5,5 млн., центральной зоны – 4-4,5 млн., на каштановых почвах южной зоны – 3-3,5 млн. всхожих семян на 1 га.  По занятым парам и при более поздних сроках сева нормы высева озимых увеличивают на 10-15%.

В сложившихся условиях 2021 года при запасах продуктивной влаги менее 20 мм рекомендованные нормы высева необходимо уменьшить на 0,2 – 0,5 млн. всхожих семян на 1 га.

Глубина заделки семян определяется, прежде всего, влажностью почвы и её механическим составом. На черноземах глубина заделки почвы составляет 6-8 см, в случае пересыхания верхнего слоя глубину можно увеличить до 8-10 см. На тяжёлых суглинистых почвах глубина заделки составляет 4-5 см. Перспективным для условий 2021 года является использование современных посевных комплексов типа Condor (Аmasone) с долотовидными  сошниками.

Сорта. В Оренбургской области рекомендуются к возделыванию сорта озимой пшеницы: Оренбургская 105, Пионерская 32, Колос Оренбуржья, Калач 60, Скипетр, Поволжская 86, Жемчужина Поволжья, Кинельская 4, Безенчукская 380, Поволжская Нива, Донмира, Рифей.

Уход за посевами.Уход за посевами озимой пшеницы включает послепосевное прикатывание, снегозадержание, весеннее боронование, борьбу с сорняками, вредителями, болезнями и полеганием.

Если прикатывание не идет одновременно с посевом, то рекомендуется  послепосевное  прикатывание, особенно в сухую ветреную погоду. При прикатывании улучшается контакт семян с почвой, что обеспечивает более дружное появление всходов.

Для повышения урожайности важным приемом является снегозадержание. Одним из наиболее эффективных способов является посев кулис из высокорослых растений. Для условий Оренбургской области в наибольшей степени подходит сорго сахарное. Сорго высевают в пару за 1-1,5 месяца до посева озимой пшеницы по 2-4 рядка с шириной междурядья  60-70 см, или по 5-6 рядков с междурядьем 15-22 см.

Весеннее боронование озимых культур широко используется для разрушения почвенной корки, однако оценка его не может быть однозначной и требует разумного подхода. Нельзя проводить боронование изреженных и слаборазвитых озимых, которое приводит к еще большему их изреживанию.  Весеннее боронование повышает урожайность озимой пшеницы на  2-3 ц/га, можно проводить его зубовыми или пружинными боронами. Ранневесеннее внесение азотных удобрений дисковыми сеялками, при наступлении физической спелости почвы, заменяет весеннее боронование.

Для борьбы с полеганием высокостебельных сортов озимой пшеницы используют обработку посевов ретардантами в конце кущения – начале выхода в трубку.

Уборка урожая. Уборку урожая проводят как прямым комбайнированием, так и раздельным  способом. При влажной погоде, в основном используют прямое комбайнирование,  раздельная уборка может быть использована в сухую погоду или  на более засоренных полях. Для формирования товарных партий зерна необходимо проводить предварительную оценку образцов (1-2 кг), отобранных с предварительных обмолотов или отобранных снопов. Нельзя смешивать зерно озимой пшеницы от раздельного и прямого комбайнирования, с полей, отличающихся предшественниками, а также убранное до и после дождя. Убранное зерно необходимо очистить от примесей, щуплых и битых зерен, что улучшит его качество и повысит товарность.

BBCH пшеницы (Часть 1)

BBCH пшеницы (Часть 1)

Согласно шкале ВВСН развитие культуры распределяется по соответствующим кодам, которые, в свою очередь, содержат ЕС-стадии, начиная с семян до созревания зерна и отмирания растения.

Теперь, давайте более подробно рассмотрим несколько фаз развития пшеницы.

Макростадия 00. Прорастание (00-09). Для данной фазы важны кислород, влага и соответствующие температуры, а именно минимальная температура для прорастания пшеницы – 2-3 ° С, оптимальная – 20-25 ° С. Наилучший процент влаги в зерне для прорастания – 42-45 ° С, а по меньшей мере – 30-35 ° С.

Также существует несколько подфаз прорастания. Во-первых – это фаза набухания, когда зерновка поглощает воду (0,1-0,2), что является предпосылкой для активизации жизненных процессов. Во-вторых, преобразования запасных веществ, а именно переход органических веществ в растворимую форму, для питания зародыша запасными веществами.

Также этой фазе характерно появление зародышевых корешков и колеоптиля. Заканчивается эта макростадия появлением всходов культуры.

Макростадия 1. Всходы, развитие листьев (10-19). С распространением колеоптиля к верхнему слою почвы и его выхода на поверхность появляются всходы. Идет прорастания 1-го, 2-го, 6-го, 9-го листа, но кущения еще не происходит. С появлением листьев начинается ассимиляция СО2, таким образом, растение переходит от гетеротрофного до автотрофного образа жизни.

Макростадия 2. Кущение (20-29).

На 20 микростадии кущения еще нет, потом появляется первый побег кущения, второй, третий и заканчивается максимальным числом побегов.

Во время кущения образуется большее или меньшее количество боковых побегов. Как правило, зерновые могут образовывать побеги до 5-го порядка. Кущение у пшеницы начинается осенью и заканчивается весной. И слишком большое количество боковых побегов нуждается в лишней воде и дополнительных питательных веществах. Например, учитывая опыт Северной Германии, которая для регулирования количества побегов не меняет норму высева при одинаковых условиях кущения. Также важную роль для данной фазы развития растения играет почва, ведь чем суше он будет, тем сильнее станет корневая система.

Для кущения присуща закладка колосков и цветков, эта подфаза начинается в главном побеге и продолжается на нижних. Примерно через три недели начинается закладка цветков, а через несколько дней и закладка колосьев. Именно в этот период растение как можно более чувствительно к внешним факторам, ведь условия в данный промежуток времени способствуют развитию и распространению многих заболеваний. Поэтому, агроному стоит обратить внимание на проведение таких агротехнических мероприятий, как внесение регуляторов роста и средств защиты растений.

Макротадия 3. Стеблевание или выход в трубку (30-40).

 Начинается фаза вытягиванием стебля, образованием 1-2-3-4 междоузлия, и заканчивается выходом флагового листа. Для фазы стеблевания характерно усиленное деление клеток. Интенсивность которого зависит от продолжительности светового дня. Пшеница, в свою очередь, растение длительного дня, то есть требует больше 12 часов солнца в сутки для перехода к генеративной фазе. Иногда, некоторые формы пшеницы, как яровые так и озимые, первыми потребуют перехода к генеративной фазе яровизации, то есть обеспечения потребности в холоде. Для яровизации озимой пшеницы соответствуют такие условия, как: температура – 0-3 ° С и 40-70 суток. Заканчивается стеблевание переходом в фазу колошения. 

Стратегия защиты флаг-листа озимых зерновых

30. 03.2021

Стратегия защиты флаг-листа озимых зерновых

Зерно в Российской Федерации является главным сельскохозяйственным продуктом, одним из основных факторов устойчивости экономики, гарантией продовольственной безопасности. Поэтому выращивание высококачественного зерна в нашей стране является первостепенным направлением растениеводства.

Ежегодный прирост зернового клина, насыщение севооборотов колосовыми, размещение посевов озимых по плохим с точки зрения фитосанитарии предшественниками, оптимизация затрат на обработку почвы привели к накоплению значительного запаса инфекции. Некачественно заделанные растительные остатки также являются источником накопления и распространения таких заболеваний колосовых, как септориоз, пиренофороз, мучнистая роса, виды ржавчины, гельминтоспориозные пятнистости, ринхоспориоз, фузариоз и чернь колоса.

Постоянно растущий инфекционный фон вызывает необходимость систематического проведения фунгицидных обработок. В последние 5 лет даже в годы с неблагоприятными климатическими условиями для развития болезней (дефицит осадков в период кущение-колошение) объем применения зерновых фунгицидов не снижается, а лишь возрастает.

Защита посевов фунгицидами является одним из резервов повышения урожайности, увеличения валовых сборов зерна и рентабельности сельскохозяйственного производства. Для достижения этих целей специалисты компании «Агро Эксперт Груп» рекомендуют применять систему фунгицидной защиты. Тема защиты зерновых от болезней – это предмет множества вопросов, споров, мук выбора из обширного предложения. И, основываясь на опыте нашей работы, применение фунгицидов не всегда дает ожидаемые результаты, при этом препараты для защиты от болезней – это значительная часть в структуре затрат на ХСЗР на зерновых. Разберем основные правила составления фунгицидной стратегии защиты зерновых колосовых.


Первую профилактическую обработку рекомендуется проводить при полном появлении третьего листа пшеницы. Обычно эта фаза совпадает с фазой второго междоузлия культуры (ВВСН 32).


Обработка в фазу выхода в трубку направлена на борьбу с:

  • с прикорневыми гнилями различной этиологии;
  • со снежной плесенью;
  • мучнистой росой;
  • начальными проявлениями септориоза;
  • также на Юге России могут быть вспышки желтой ржавчины – патогена, который отлично развивается при пониженных температурах воздуха.


Современный прием при обработке растений в начальные фазы развития – это использование ранневесенних фунгицидов с профилактическим действием. В ассортименте «Агро Эксперт Груп» — это новинка 2021 года Феразим Грин. Подробнее о продукте и технологии его применения можно прочитать в статье «Феразим Грин — ранневесенняя защита озимых зерновых».

 Лечебно-профилактический фунгицид Феразим Грин для ранневесенней обработки предотвращает заражение растений и помогает культуре наиболее полно заложить колоски в колосе благодаря своему физиологическому действию. Фунгицидная защита длится до 28 дней.  Также следует отметить, что благодаря мощной фунгицидной защите Феразима Грин обработка по флаг-листу может быть сдвинута по срокам, а также гарантированно будет снижен инфекционный фон при этой обработке.

Важнейший этап применения фунгицидов — флаг-лист — колошение. Вклад в урожай верхних трех листьев у колосовых культур составляет около 75–80 %, поэтому важно сохранить эти части растений живыми и свободными от болезней. При полностью развернутом флаговом листе, когда особенно активно идет процесс фотосинтеза, начинается формирование одного из факторов урожайности — массы 1000 зерен.


Поскольку интенсивность фотосинтеза напрямую зависит от наличия болезней в верхнем ярусе листьев, в этот период защитные мероприятия являются определяющими для будущего урожая. При первых признаках появления патогенов в среднем ярусе, когда флаговый лист еще можно сохранить, рекомендуется применение лечебных фунгицидов. Главный сигнал к обработке – это наличие симптомов на втором сверху листе.


Эти препараты работают в латентный (скрытый) период развития инфекции и по первым симптомам. Срок защитного действия лечебных фунгицидов не превышает 2-х недель. Все лечебные фунгициды системные, они перемещаются внутри растения снизу вверх от места нанесения.

Компания «Агро Эксперт Груп» предлагает в сезоне 2021 года новый комбинированный фунгицид для защиты зерновых культур с быстрым начальным действием – Фарго, КС (тебуконазол + ципроконазол, 250 + 80 г/л).

Почему Фарго?

  • Надежный контроль болезней листьев и стеблей зерновых.
  • Быстрое начальное действие на патогены благодаря ципроконазолу. Он быстро поглощается листьями (30 мин. после обработки) и переходит с одной поверхности листа на другую. Это свойство продукта крайне важно при борьбе со ржавчиной и в случае запоздалых обработок.
  • Мощное лечебное действие – высокая эффективность при работе по симптомам.
  • Хорошая переносимость растениями. Не вызывает ожогов листьев благодаря использованию «зеленого» растворителя.
  • Отличная дождестойкость благодаря высокой скорости проникновения.

Против каких болезней эффективен Фарго?

Препарат за счет сочетания двух действующих веществ тебуконазола и ципроконазола подавляет широкий спектр листовых болезней зерновых культур (рис. 5).


Когда применять Фарго?


Обработку против ржавчины и гельминтоспориозных пятнистостей (на ячмене) нужно проводить при первых признаках болезней у 30 % растений. Эти заболевания развиваются стремительно, поэтому обнаружение первых единичных симптомов – это сигнал к фунгицидной обработке. По септориозным пятнистостям и ринхоспориозу обработка Фарго должна быть проведена при 5 % развитии заболевания у 40 % посева.  

Высокая эффективность Фарго против широкого спектра заболеваний зерновых культур подтверждена многочисленными опытами, проведенными в различных климатических зонах РФ. Так, на озимой пшенице через 14 дней после обработки против бурой ржавчины эффективность Фарго в норме 0,5 л/га составила 92–96 %, контроль септориоза был на уровне 85–87 %.


При запоздалых обработках и благоприятных погодных условиях инфекционный фон увеличивается в геометрической прогрессии. Необходимо быстро остановить развитие патогенов. В таких случаях применяют лечебные фунгициды со стоп-эффектом, например, Флинт (ципроконазол + эпоксиконазол, 80 + 120 г/л). Благодаря повышенной норме ципроконазола, Флинт быстро останавливает развитие болезни, что обеспечивает сохранность еще живой ткани, а значит, налив зерна будет продолжаться.

Фунгицидные обработки – это один из самых дорогостоящих приемов в защите растений. И поэтому работа по защите растений от болезней требует обширных технических знаний, так она значительно влияет на себестоимость производимой продукции. Ошибки в фунгицидной защите для агронома — непозволительная роскошь. Поэтому специалисты компании «Агро Эксперт Груп» готовы оказать консультационную поддержку по применению фунгицидов в вашем хозяйстве.

Опыт многих хозяйств РФ свидетельствует, что использование систем фунгицидной защиты зерновых от «Агро Эксперт Груп» не только полностью решает проблему с болезнями на зерновых полях, но и сделает это с минимальными затратами финансовых средств. Химические средства защиты растений «Агро Эксперт Груп» — основа достижения высоких результатов и финансового благополучия хозяйств.

До встречи на полях!

Алексей Денисов,
менеджер по зерновым и кукурузе
ООО «Агро Эксперт Груп»



Справочник по болезням и вредителям пшеницы

Справочник по болезням и вредителям пшеницы

Болезни и вредители пшеницы: руководство по полевой идентификации

Автор оригинального текста: Дж. М. Прескотт, П. А. Бернетт, Э. Э. Саари, Дж. Рэнсон, Дж. Боуман, В. де Миллиано, Р. П. Сингх, Г. Бекеле . МЕЖДУНАРОДНЫЙ ЦЕНТР УЛУЧШЕНИЯ КУКУРУЗЫ И ПШЕНИЦЫ (www.cimmyt.org). CENTRO INTERNACIONAL DE MEJORAMIENTO DE MAIZ Y TRIGO. Лиссабон 27, Апдо. Почтовый 6-641, 06600 Мексика, D.Ф., Мексика.
HTML-версия разработана с разрешения CIMMYT: J. Wong , USDA-ARS-WRRC, Олбани, Калифорния; Д. Э. Мэтьюз , Деп. селекции растений и биометрии, Корнельский университет, Итака, Нью-Йорк и K. D. Kephart , Dep. агрономии, Университет Миссури, Колумбия, штат Миссури.

Предисловие

Этот буклет представляет собой краткое руководство по выявлению болезней пшеницы и тритикале в полевых условиях. Он предназначен в первую очередь для сельскохозяйственных исследователей, технических специалистов и фермеров в развивающихся странах, но также будет полезен для других.Текст содержит краткое описание основных болезней пшеницы и тритикале, насекомых-вредителей, нематод, физиологических и генетических нарушений, а также минеральных и экологических стрессов. Этот текст дополняют и помогают идентифицировать многочисленные цветные фотографии 1 /, рисунки 2 / и краткий диагностический ключ. В случае конкретных причинных организмов за идеальным сценическим псевдонимом (если он известен) следует несовершенное сценическое имя в скобках. Хотя большинство включенных болезней, вредителей, расстройств или стрессов могут быть экономически значимыми, некоторые из них не представлены и представлены только потому, что они уникальны или могут быть перепутаны с более экономически значимыми проблемами.

  1. Все фотографии являются комплиментами сотрудников CIMMYT, за исключением фотографии 57, предоставленной CC Gill, Agriculture Canada, Виннипег, Манитоба, Канада, и фотографии 70, предоставленной JH Hatchett, USDA-ARS, Государственный университет Канзаса, Манхэттен, Канзас , СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ.
  2. Штриховые рисунки воспроизведены из книги «Вредители Новой Зеландии и полезных насекомых» (ред. Р. Р. Скотт) с любезного разрешения Линкольн-колледжа, Новая Зеландия.

Содержание

Руководство по диагностике
Грибковые заболевания
Листовая ржавчина (коричневая ржавчина)
Stem Rust (Черная ржавчина)
Stripe Rust (Желтая ржавчина)
Обыкновенная и карликовая головня (Вонючая головня)
Karnal Bunt (Частичная овсянка)
Сыпучая головня
Flag Smut (Флаговая головня)
Мучнистая роса
Septoria Tritici Blotch
Септориа Нодорум Блотч
Septoria Avenae Blotch
Пятнистая пятнистость (пятнистость листьев гельминтоспория)
Желтое пятно (желтое пятно или пятно на листьях)
Альтернариозная болезнь листьев
Пятно на листьях фузариоза (снежная плесень)
Парша (упадок головы)
Спорынья
Черная точка
Ложная мучнистая роса
Take-All
Eyespot (Strawbreaker)
Острое пятно и корневая гниль ризоктонии
Обычная корневая гниль, гниль стопы и коронная гниль
Склероциевое увядание (Южный упадок)
Черная плесень (сажистая форма)
Бактериальные болезни
Бактериальная черная полова и бактериальная полоса
Гниль базальной слизистой оболочки и бактериальный ожог листьев
Бактериальная гниль (желтая гниль ушей)
Вирусные болезни
Ячмень желтый карлик
Насекомые-вредители
Тля
Stink Bugs
Армейские черви, совки и стеблевидные мотыльки
Зерновой листоед
Трипс
Hessian Fly
Личинка стебля пшеницы
Пилильщик
Белые личинки
Проволочники
Слизни, улитки, кузнечики и сверчки
Клещи
Нематоды
Семенная нематода галловой (пшеничная нематода или молочница)
Киста злаков, нематода
Нематода корневого узла
Физиологические и генетические заболевания
Физиологическая пятнистость листа
Меланизм и коричневый некроз (ложная черная мякина)
Генетическая вкрапленность
Гибридный некроз (скопление гномов)
Минеральные и экологические нагрузки
Дефицит азота, фосфора и калия
Незначительные недостатки элементов
Токсичность алюминия
Солевой стресс
Влажный стресс
Тепловой стресс
Повреждение гербицидом
Морозный урон
Глоссарий

-------------------------------------------------- ------------------------------
Симптомы Возможное расстройство
-------------------------------------------------- ------------------------------
Лист или оболочка листа
-------------------

* Поднятые пустулы с желтой листовой ржавчиной (коричневая ржавчина)
 оранжевые или черные споры Стеблевая ржавчина (Black Rust)
                                     Stripe Rust (желтая ржавчина)
                                     Пометить Smut

* Поверхностная белая, розоватая или мучнистая роса
 сероватая грибковая ткань Парша (Head Blight)

* Поверхностная темная грибковая ткань Пятно Пятна
                                     Черная точка
                                     Черная плесень

* Темные плодовые тела грибов Septoria Tritici Blotch
 в коричневато-серых очагах

* Пятна листовой ржавчины (коричневая ржавчина)
                                     Стеблевая ржавчина (Черная ржавчина)
                                     Stripe Rust (желтая ржавчина)
                                     Мучнистая роса
                                     Пятно пятно
                                     Ячмень желтый карлик
                                     Трипсы
                                     Клещей
                                     Генетическая пятнистость

* Пятна загара
                                     Физиологическая пятнистость листа
                                     Меланизм и коричневый некроз
                                     Генетическая пятнистость
                                     Повреждение гербицидом

* Поражения или пятна, напоминающие листовую ржавчину (коричневая ржавчина)
 нимб с контрастной цветной стеблевой ржавчиной (Black Rust)
 бордюр Stripe Rust (Желтая ржавчина)
                                     Пятно загара
                                     Физиологическая пятнистость листа
                                     Незначительные недостатки элементов

* Другие виды пятен Fusarium Leaf Blotch (Snow Mold)
                                     Гниль базальной слизистой оболочки / бактериальный ожог листьев
                                     Ячмень желтый карлик
                                     Повреждение гербицидом
                                     Урон от мороза

* Экссудат от желтого до серо-белого. Черная мякина / бактериальная полоса.
                                     Гниль базальной слизистой оболочки / бактериальный ожог листьев

* Пожелтение, хлороз, некроз, флаговая головня
 задержка роста Take-All
                                     Глазное пятно (Strawbreaker)
                                     Острое пятно и корневая гниль ризоктонии
                                     Обычная корневая гниль, гниль стопы и гниль кроны
                                     Склероциевое увядание (Южный упадок)
                                     Ячмень желтый карлик
                                     Армейские черви, совки и стебликовые мотыльки
                                     Проволочники
                                     Семенная галловая нематода
                                     Киста злаков нематода
                                     Нематода с корневым узлом
                                     Недостаток азота, фосфора и калия
                                     Токсичность алюминия

* Покраснение, задержка роста Ячмень Желтый Карлик
                                     Недостаток азота, фосфора и калия

* Деформированная, скрученная, свернутая, Flag Smut
 скрученные или утолщенные листья ложная мучнистая роса
 и / или листовые влагалища Ячмень Yellow Dwarf
                                     Клещей
                                     Семенная галловая нематода
                                     Незначительные недостатки элементов
                                     Повреждение гербицидом

* Жеванные, рваные, съеденные или совковые черви, совки и стебликовые мотыльки
 недостающие листья Слизни, улитки, кузнечики и сверчки

* Жеванные продольные полосы Жук-листоед
                                     Слизни, улитки, кузнечики и сверчки

Стебель или листовая оболочка
-------------------

* Поднятые пустулы с желтой листовой ржавчиной (коричневая ржавчина)
оранжевые, коричневые или черные споры Стеблевая ржавчина (Черная ржавчина)
                                     Stripe Rust (желтая ржавчина)

* Поверхностная белая, розоватая или мучнистая роса
 сероватая грибковая ткань

* Черная блестящая ткань грибка Take-All
 под оболочкой листа

* Коричневатое удлиненное отчетливое пятно для глаз (Strawbreaker)
 очаги в форме глаза Sharp Eyespot / Rhizoctonia Root Rot

* Однородная коричнево-коричневая обычная гниль корня, гниль стопы и гниль кроны
 изменение цвета

* Пятна от коричневых до черных или пятна Septoria Tritici
 полосы Черная мякина / Бактериальная полоса
                                     Физиологическая пятнистость листа

* Полегание, сломанные стебли Пятнистая пятнистость
                                     Глазное пятно (Strawbreaker)
                                     Острое пятно и корневая гниль ризоктонии
                                     Гессенская муха
                                     Личинка стебля пшеницы
                                     Пилильщик
                                     Урон от мороза

Корень или коронка
-------------

* Темноватые гнили, поражения Take-All
                                     Обычная корневая гниль, гниль стопы и гниль кроны

* Плодовые тела от белого до черного Sclerotium Wilt (Southern Blight)

* Белый мицелий обыкновенная гниль корней, гниль стопы и гниль кроны
                                     Склероциевое увядание (Южный упадок)

* Блестящий черный узел короны Take-All

* Деформированная, узловатая или короткая нематода кисты злаков
 корни корневой узел нематода
                                     Токсичность алюминия

* Прикрепленные белые или коричневые галлы, совки, совки и стебликообразные
 кисты или узелки Белые личинки
                                     Проволочники

* Отрезанные или пережеванные корни армейские черви, совки и стеблевые мотыги
                                     Белые личинки
                                     Проволочники

Голова
----

* Весь шип черный, преобразованный Loose Smut
 в порошкообразную массу

* Поднятые пустулы с желтой листовой ржавчиной (коричневая ржавчина)
 оранжевые, коричневые или черные споры Стеблевая ржавчина (Black Rust)
                                     Stripe Rust (желтая ржавчина)

* Поверхностная белая, розоватая или мучнистая роса
 сероватая грибковая ткань Парша (Head Blight)

* Поверхностная темная грибковая ткань Черная плесень (сажистая плесень)

* Коричневые, черные или фиолетовые пятна Septoria Tritici Blotch
 или полосы на чешуйках Пятнистая пятнистость
                                     Коричневое пятно (желтое пятно на листе или пятно)
                                     Черная мякина / бактериальная полоса
                                     Меланизм и коричневый некроз

* Желтый экссудат Черная мякина / Бактериальная полоса
                                     Бактериальный шип

* Вся голова белая, форсированная листовая ржавчина (коричневая ржавчина)
 созревание, семена сморщены или черная плесень (сажистая плесень)
 отсутствует Ячмень желтый карлик
                                     Вонючие ошибки
                                     Личинка стебля пшеницы
                                     Пилильщик
                                     Незначительные недостатки элементов
                                     Урон от мороза

* Голова скручена или иначе ложная мучнистая роса
 искажены, могут не появиться из-за бактериального шипа
 лист влагалища ячмень Yellow Dwarf
                                     Семенная галловая нематода
                                     Незначительные недостатки элементов
                                     Повреждение гербицидом
                                     Урон от мороза

Семя
----

* Обесцвечивается с изменением формы,
 размер и / или текстура

-    Черный цвет; рассыпчатая головня, трансформированная семенами
     в порошкообразную массу

- Цвет от серого до черного; семя обыкновенная и карликовая головня (вонючая головня)
     легко измельчается и имеет Karnal Bunt (частичную головку)
     сильный запах

- Цвет от коричневого до черного; семена спорыньи
     жесткий (стр.34)

- Частично обесцвечен; семя Карнал Бунт (Частичная Бунта)
     содержит черный, пудровый
     споры, резкий запах при
     раздавлен

* Обесцвечивание семян только Alternaria Leaf Blight
                                     Парша (упадок головы)
                                     Черная точка
                                     Черная плесень (сажистая плесень)
                                     Семенная галловая нематода

Весь завод
------------

* Участки низкорослого или поврежденного Take-All
 растения по всему полю Eyespot (Strawbreaker)
                                     Острое пятно и корневая гниль ризоктонии
                                     Обычная корневая гниль, гниль стопы и гниль кроны
                                     Склероциевое увядание (Южный упадок)
                                     Ячмень желтый карлик
                                     Белые личинки
                                     Киста злаков нематода
                                     Солевой стресс
                                     Влага Стресс
                                     Перегрев

* Скопление гномов Гибридный некроз (Скопление гномов)
-------------------------------------------------- ------------------------------
 

Грибы отличаются от других растений тем, что они не содержат хлорофилла и, следовательно, не обладают способностью к фотосинтезу.Вместо того, чтобы производить себе пищу, грибы поглощают питательные вещества из живой или мертвой ткани хозяина. Грибки распространяются по-разному: они могут передаваться через семена или почву, или они могут распространяться ветром, водой (дождь, поливная вода), насекомыми, животными и человеком.

Заражение грибковыми патогенами зависит от нескольких факторов: обычно требуется свободная вода на поверхности растения-хозяина, восприимчивость хозяина, плотность посевного материала и температура окружающей среды, а также другие факторы окружающей среды.В то время как некоторые грибы атакуют только один или несколько видов хозяев, другие атакуют многие. Симптомы и развитие болезни являются функцией взаимодействия паразита и хозяина. Симптомы могут быть похожими или разными, в зависимости от пораженных грибов. Следовательно, положительная идентификация грибов должна основываться на их морфологии. Если не указано иное, грибы, включенные в это руководство, вызывают заболевания мягкой пшеницы, твердой пшеницы и тритикале.

—————————————-

Листовая ржавчина (коричневая ржавчина) Puccinia recondita

Симптомы: Постулы круглые или слегка эллиптические, меньше, чем у стеблевой ржавчины, обычно не сливаются и содержат массы от оранжевых до оранжево-коричневых уредиоспор.Места заражения в первую очередь обнаруживаются на верхней поверхности листьев и их влагалищах (1), а иногда и на шейке и остях.

Развитие: Первичные инфекции обычно легкие и развиваются от переносимых ветром уредиоспор, которые могли распространяться на большие расстояния. Заболевание может быстро развиваться при наличии свободной влаги и температуре около 20 ° C. Последовательные поколения уредиоспор могут производиться каждые 10-14 дней при благоприятных условиях. По мере созревания растений или при неблагоприятных условиях окружающей среды массы черных телиоспор могут стать очевидными (2).

Хозяева / распространение: Листовая ржавчина может поражать пшеницу, тритикале и многие другие родственные травы. Заболевание встречается везде, где выращивают злаки умеренного климата. Альтернативными хозяевами являются Thalictrum , Isopryum , Anemonella и Anchusa spp.

Важность: Тяжелые ранние заражения могут привести к значительным потерям урожая, в основном из-за уменьшения количества ядер на шип, веса теста и качества ядра.

—————————————-

Стебель ржавчины (Черная ржавчина) Puccinia graminis f.sp. tritici

Симптомы: Пустулы (содержащие массу уредиоспор) имеют темно-красновато-коричневый цвет и могут появляться на обеих сторонах листьев, на стеблях и на шипах (3). При легких инфекциях пустулы обычно разделены и разбросаны, но при тяжелых инфекциях они могут сливаться.До образования пустулы могут появиться «пятнышки». До того, как споровые массы прорвутся через эпидермис, места заражения становятся грубыми на ощупь; когда массы спор прорываются, поверхностные ткани приобретают рваный и рваный вид.

Развитие: Первичные инфекции обычно легкие и развиваются от переносимых ветром уредиоспор, которые могли распространяться на большие расстояния. Заболевание может быстро развиваться при преобладании свободной влаги (дождь или роса) и умеренных температур.Если средняя температура составляет около 20 ° C или выше, первое поколение уредиоспор будет произведено через 10-15 дней. По мере созревания растений могут образовываться массы черных телиоспор.

Хозяева / распространение: Стеблевая ржавчина может поражать пшеницу, ячмень, тритикале и многие другие родственные травы; он встречается везде, где выращивают злаки умеренного климата. Альтернативными хозяевами являются виды Berberis и Mahonia spp.

Значение: Если заражение происходит на ранних стадиях урожая, последствия могут быть серьезными: снижение кущения и потеря веса и качества зерна.При благоприятных условиях может произойти полная потеря урожая.

—————————————-

Полоса ржавчины (Желтая ржавчина)

Puccinia striiformis

Симптомы: Пустулы полосатой ржавчины, содержащие уредиоспоры от желтого до оранжево-желтого цвета, обычно образуют узкие полосы на листьях (4). Пустулы также можно найти на листовых влагалищах, шейках и чешуях (5).

Развитие: Первичные инфекции вызываются уредиоспорами, переносимыми ветром, которые могли распространяться на большие расстояния.Заболевание может быстро развиться при наличии свободной влаги (дождя или росы) и при температуре от 10 до 20 ° C. При температуре выше 25 ° C образование уредиоспор снижается или прекращается, и часто образуются черные телиоспоры (6).

Хозяин / Распространение: Полосатая ржавчина может поражать пшеницу, ячмень, тритикале и многие другие родственные травы. Заболевание встречается во всех высокогорных и / или умеренных районах, где выращивают зерновые. Альтернативный хост не известен.

Важность: Тяжелые инфекции могут привести к потере урожая, в основном из-за уменьшения количества ядер на шип, веса теста и качества ядра.

—————————————-

Обыкновенная и карликовая головня (Вонючая головня)

Tilletia caries , T. foetida , T. controversa

Симптомы: Основными симптомами, вызываемыми этими тремя видами, являются грибковые образования, называемые «головными шариками», которые напоминают ядра, но полностью заполнены черными телиоспорами. Шарики обыкновенной головни, вызванные вирусом T.caries и T. foetida примерно того же размера и формы, что и ядра, которые они заменяют (7); у карликовой головни, вызванной T. controversa, более близки к сферической форме (8). Когда шарики из головни раздавлены, они издают зловонный или рыбный запах. Зараженные колючки имеют тенденцию быть голубовато-зеленого цвета (или более темными), а чешуйки имеют тенденцию слегка раздвигаться; шарики с головкой часто становятся видимыми после стадии размягчения теста (9,10; стр. 11). Небольшое уменьшение высоты растений характерно для головни обыкновенной, тогда как для карликовой головни характерно выраженное уменьшение высоты.

Развитие: Споры, спящие в почве или на семенах, прорастают и заражают прорастающие семена. Заражению способствует прохладная температура во время прорастания. Заболевание развивается системно, видимые симптомы появляются после колошения.

Хозяева / распространение: Пшеница и (реже) тритикале поражаются этими болезнями, как и некоторые другие родственные травы. Обыкновенные и карликовые головня встречаются по всему миру. Оба ограничены умеренным климатом; карликовая головня встречается в районах с длительным снежным покровом.

Значение: Значительные потери урожая могут произойти при выращивании восприимчивых сортов или при отсутствии химической обработки семян.

—————————————-

Карнальная овсянка (частичная)

Tilletia indica (син. Neovossia indica )

Симптомы: Карнальную головню нелегко обнаружить до сбора урожая, поскольку обычно болезнь поражает лишь несколько ядер на колосе.После сбора пораженные ядра можно легко обнаружить при визуальном осмотре: масса черных телиоспор заменяет часть эндосперма, а околоплодник может быть целым или разорванным (11). Больные ядра издают зловонный или рыбный запах при раздавливании.

Развитие: Карнальская головня представляет собой передаваемую через семена или почву болезнь, поражающую цветы. инокулят (телиоспоры) на поверхности почвы или вблизи нее прорастает, образуя споридии, которые ветром переносятся к структурам цветка.Эти споридии, в свою очередь, прорастают и проникают в чешуйки, рахис или сам яичник. Грибок проникает в новообразованное ядро ​​и развивается в межклеточном пространстве между эндоспермом и семенной оболочкой. Степень становления и развития болезни зависит от условий окружающей среды — от появления колосов до налива зерна.

Хозяева / распространение: Карнальная головня может поражать пшеницу, тритикале, рожь и некоторые другие родственные травы, но не ячмень. Заболевание эндемично для Азиатского субконтинента, а теперь и в Мексике.

Значение: Карнальная головня — относительно незначительное заболевание. Фактические потери урожая минимальны, но болезнь занесена в карантинные списки многих стран и поэтому имеет важное значение в мировой торговле зерном.

—————————————-

Сыпучая головня

Ustilago tritici

Симптомы: Все соцветие, кроме рахиса, замещено массами спор головни (12).Эти черные телиоспоры часто уносятся ветром, оставляя только голый стержень и остатки других цветочных структур (13).

Разработка: Выносимые ветром телиоспоры, попадающие на цветки растений пшеницы, могут прорасти и заразить развивающийся зародыш ядра. Мицелий рыхлой головни остается в спящем состоянии в зародышевых тканях ядра до тех пор, пока ядро ​​не начнет прорастать. Затем мицелий развивается вместе с точкой роста растения и во время цветения заменяет цветочные части колоса массами черных спор.Инфекции и развитию болезней способствуют прохладные и влажные условия, которые продлевают период цветения растения-хозяина.

Хозяева / распространение: Заболевание может возникать везде, где выращивается пшеница.

Значение: Потери урожая зависят от количества колосьев, пораженных болезнью; заболеваемость обычно составляет менее одного процента и редко превышает тридцать процентов спайков в любом конкретном месте.

—————————————-

Флаговая головня

Urocystis agropyri

Симптомы: Массы черных телиоспор образуются в виде узких полосок непосредственно под эпидермисом листьев, оболочкой листьев и иногда стеблями.Больные растения часто отстают в росте, обильно растут и колючки могут не прорасти. Тяжелая инфекция обычно вызывает скручивание листьев, в результате чего они выглядят как листья лука. Эпидермис старых больных растений имеет тенденцию к измельчению, высвобождая телиоспоры (14).

Развитие: Прорастающие зерна или очень молодые проростки заражаются спорами, прорастающими на семенах или в почве. Заболевание продолжает системно развиваться, и рядом с колосом становятся видны черные субэпидермальные полоски телиоспор.Заражению способствует низкая влажность почвы и низкие температуры почвы.

Хозяева / распространение: Хлебная пшеница является основными хозяевами грибов флаговой головни, и изоляты, поражающие мягкую пшеницу, имеют тенденцию быть таковыми исключительно. Сообщений о флаговой головне на твердой пшенице и тритикале мало. Болезнь встречается в большинстве районов озимой пшеницы и в прохладных, осенних посевах яровой пшеницы.

Значение: Флаговая головня, как правило, не является экономически важным заболеванием, но там, где она присутствует, потери урожая могут варьироваться от следовых количеств до умеренных уровней (при выращивании восприимчивых сортов).

—————————————-

Мучнистая роса

Erysiphe graminis f. sp. tritici

Симптомы: У всех хозяев первыми видимыми симптомами этого заболевания являются белые или бледно-серые, нечеткие или порошкообразные колонии мицелия и конидии на верхних поверхностях листьев и влагалищах листьев (особенно на нижних листьях) (15), и иногда на шипах. Более старая ткань гриба желтовато-серая (16).Этот поверхностный грибковый материал можно легко стереть пальцами. Ткань хозяина под грибковым материалом становится хлоротичной или некротической, и при тяжелых инфекциях листья могут погибнуть. Со временем в мицелии могут развиться черные сферические плодовые структуры (клейстотеции), которые можно увидеть без увеличения.

Развитие: Развитию мучнистой росы способствуют прохладные (15-22 ° C), пасмурные и влажные (относительная влажность 75-100%) условия.

Хозяева / Распространение: Гриб имеет высокую степень специфичности хозяина. Только изоляты, поражающие пшеницу; то же самое можно сказать и о изолятах, поражающих ячмень, овес и рожь. Дальнейшая специализация существует в виде гонок. Мучнистая роса встречается во всем мире в прохладных, влажных и полузасушливых районах, где выращиваются злаки.

Значение: Мучнистая роса может привести к значительным потерям урожая, если заражение происходит в начале цикла урожая и условия остаются благоприятными для развития, так что высокие уровни заражения достигаются еще до колошения.

—————————————-

Септориоз
Септориа Тритичи Блотч
Mycosphaerella graminicola ( Septoria tritici )
Септориа Нодорум Блотч
Leptosphaeria nodorum ( S. nodorum )
Septoria Avenae Blotch
Leptosphaeria avenaria f.sp. triticea ( S.avenae f.sp. triticea )
Симптомы: Начальные очаги инфекции обычно имеют неправильную форму, от овальных до удлиненных хлоротичных пятен или поражений. По мере расширения этих участков центры поражений становятся бледными, соломенными и слегка некротическими, часто с многочисленными маленькими черными точками (пикнидами) (17). Поражения пятнами septoria tritici имеют тенденцию быть линейными и ограниченными латерально (18), в то время как пятна septoria nodorum (19) и septoria avenae blotch имеют более линзовидную форму.Могут быть поражены все надземные части растения. Легкое заражение вызывает только рассеянные поражения, но тяжелое заражение может убить листья, колючки (20 — это S. nodorum ) или даже все растение. Идентификация видов в полевых условиях может быть трудной, и часто требуется микроскопическое исследование.

Развитие: Первоначальное заражение, как правило, поражает нижние листья, прогрессирует до верхних листьев и колосьев, если условия окружающей среды остаются благоприятными. Прохладные температуры (10-15С) и продолжительная влажная пасмурная погода способствуют развитию этих заболеваний.

Хозяева / распространение: Это в основном болезни пшеницы, но другие зерновые в некоторой степени восприимчивы. Заболевания распространяются только на районы выращивания пшеницы с умеренным климатом, где преобладают прохладные и влажные условия.

Значение: Значительные потери могут произойти из-за сморщивания семян и более низкой тестовой массы, если эти болезни достигают серьезного уровня до сбора урожая.

—————————————-

Пятнистость листьев гельминтоспория (пятнистая)

Cochliobolus sativus ( Helminthosporium sativum ) Syn. Bipolaris sorokiniana , Drechslera sorokiniana

Симптомы: Поражения, вызванные этим заболеванием, имеют удлиненную или овальную форму и обычно темно-коричневого цвета. По мере созревания поражения центры часто меняют цвет от светло-коричневого до желто-коричневого, окруженные неправильным темно-коричневым кольцом (21 на листе; 22 на колосе).

Развитие: Первичные инфекции, как правило, возникают на нижних листьях, начиная с хлоротичных пятен или пятен.Эти очаги инфекции увеличиваются, становятся темно-коричневыми и часто сливаются. При тяжелой форме заболевания пораженные листья или влагалища листьев могут преждевременно погибнуть.

Хозяева / распространение: Пятнистая пятнистость поражает пшеницу, тритикале, ячмень и большинство злаков. Он встречается во всем мире, но особенно распространен в более влажных районах с большим количеством осадков.

Значение: Если заражение происходит в начале цикла урожая и условия остаются благоприятными для развития, возможна полная дефолиация; Это приведет к значительному снижению урожайности и сильно сморщенным ядрам.

—————————————-

Подпал (желтое пятно или пятно на листьях)

Pyrenophora trichostoma ( Helminthhosporium tritici-repentis ) Syn. P. tritici-repentis , Drechslera tritici-repentis

Симптомы: Сначала поражения проявляются в виде желто-коричневых или коричневых пятен, которые разрастаются в большие, неправильные, желтовато-коричневые пятна овальной или линзовидной формы с желтым или хлоротическим краем (23).Когда эти пятна сливаются, образуются большие пятна. Для болезни характерно развитие пятна от темно-коричневого до черного в центре поражения. По мере развития болезни могут погибнуть целые листья, колючки и даже целые растения.

Развитие: Первоначальное заражение происходит от пораженных остатков сельскохозяйственных культур в почве или от больных травяных растений-хозяев. Обычно в первую очередь поражаются нижние листья, а при благоприятных условиях болезнь переходит на верхние листья и влагалище.Это заболевание развивается в широком диапазоне температур, и ему способствуют длительные периоды (18 часов и более) росы или дождя.

Хозяева / распространение: Пятно загара может поражать пшеницу и некоторые родственные травы; реже поражаются тритикале, ячмень и рожь. Заболевание встречается в основных районах выращивания пшеницы с умеренным климатом.

Значение: В тяжелой форме загар может вызвать преждевременную гибель листьев, тем самым снижая урожай за счет снижения контрольной массы и вызывая высокую степень сморщивания кенеля.Это заболевание приобрело более серьезное значение в связи с более широким применением агрономических методов с минимальной и / или нулевой обработкой почвы, которые оставляют на месте растительные остатки.

—————————————-

Альтернариоз листьев

Alternaria triticina

Симптомы: Появляются маленькие, хлоротичные, овальные или эллиптические поражения, которые по мере увеличения становятся неправильными.Хлоротичные границы поражений могут стать размытыми и приобретать цвет от светлого до темно-коричневого (24). Поражения трудно отличить от поражений, вызванных Helminthosporium spp. Заражение обычно начинается с нижних листьев, но симптомы можно обнаружить на всех частях растения.

Развитие: Гриб выживает в виде конидий на семенах или мицелий внутри семян. спороношение на нижних листьях дает посевной материал, который может разноситься ветром, что приводит к вторичному распространению болезни.Посевной материал, переносимый семенами, часто приводит к заражению колосами на поздних этапах цикла урожая. Высокая влажность или полив, а также более высокие температуры (от 20 до 25 ° C) способствуют развитию инфекций и болезней.

Хозяева / распространение: Хлебная и твердая пшеница, а также несколько родственных трав являются основными хозяевами. Заболевание распространено в восточных и центральных районах Азиатского субконтинента.

Значение: Альтернария может быть очень серьезной, если условия окружающей среды благоприятны для развития болезни; большие потери могут возникнуть при выращивании восприимчивых сортов.

—————————————-

Пятно на листьях фузариоза (снежная плесень)

Calonectria nivalis ( Fusarium nivale )

Симптомы: Пятна, вызванные этим организмом, становятся очевидными на листьях примерно на стадии позднего сращивания или ранней стадии роста ростков. Молодые поражения проявляются в виде участков овальной или эллиптической формы с серовато-зелеными пятнами, обычно располагающихся там, где изгибается лист (25).Поражения быстро увеличиваются в размерах, превращаясь в большие пятна-«пятна» с обесцвеченными или светло-серыми центрами; листья имеют тенденцию к расколу или крошке, начиная с центров поражений (26). Грибок также может вызывать ожог проростков, гниль стопы, паршу на головке (27), а у озимых зерновых — розовую снежную плесень.

Развитие: Споры образуются на растительных остатках, оставленных на поверхности почвы или вблизи нее. Эти споры передаются на листья ветром или проливным дождем. Развитию болезни способствует прохладная влажная погода.

Хозяева / распространение: Как правило, болезнь поражает твердую пшеницу и тритикале больше, чем мягкую пшеницу или рожь; овес и ячмень обладают иммунитетом. Сообщения показывают, что болезнь ограничена Восточной Африкой, высокогорными районами Мексики, Андским регионом Южной Америки и некоторыми частями южного Китая.

Значение: Тяжелое развитие болезни может привести к полной дефолиации, что приведет к плохому развитию зерна, сморщиванию и низкой тестовой массе (28).

—————————————-

Парша (гниль головы)

Fusarium spp.

Симптомы: Зараженные соцветия (особенно внешние чешуйки) становятся слегка затемненными и маслянистыми (29). Конидиоспоры образуются в спородохиях, что придает шипу ярко-розоватый цвет (30). Зараженные ядра могут быть пропитаны мицелием, а поверхность соцветий полностью покрыта белыми сплетенными мицелиями.

Развитие: Некоторые виды Fusarium могут поражать колосья мелких зерновых злаков; яичники инфицированы во время цветения, и заражению способствует теплая и влажная погода во время и после колошения. Для заражения требуется температура от 10 до 28 ° C. После того, как произошло первичное инфицирование, болезнь может распространяться от цветочка к цветку путем роста мицелия через структуру колоса.

Хозяева / распространение: Этой болезнью могут поражаться все мелкозерновые злаки.Fusarium spp. присутствуют почти во всех почвах и растительных остатках.

Значение: Сильный уровень заражения может привести к потере урожая более 50% и значительному снижению качества зерна. Ядра от больных колосков часто сморщиваются. Собранное зерно, содержащее более 5% зараженных зерен, может содержать достаточно токсина, чтобы нанести вред людям и животным.

—————————————-

Спорынья

Claviceps purpurea

Симптомы: Во время цветения инфицированные соцветия выделяют желтоватый, липкий, сладкий экссудат (содержащий конидии), который виден на чешуях.По мере созревания колоса ядра инфицированных соцветий заменяются коричневыми или пурпурно-черными грибковыми образованиями (склероциями или «тельцами спорыньи») (31). Эти тела спорыньи могут достигать 20 мм в длину (32).

Развитие: Первичная инфекция происходит от аскоспор плодовых тел, образованных склероциями урожая прошлого года. Аскоспоры поражают соцветия, которые затем выделяют липкий экссудат, содержащий конидии. Насекомых привлекает сладкий экссудат, и они переносят конидии к здоровым соцветиям в том же колосе или к соседним колосам.Дождливая или влажная погода способствует выделению экссудата и спор. В каждом зараженном цветке развивается тело спорыньи; эти грибковые структуры могут сохраняться в почве от одного сезона к другому, а в засушливых условиях они могут оставаться жизнеспособными в течение многих лет. Склероции требуют низких температур, прежде чем они смогут прорасти.

Хозяева / распространение: Спорынья встречается во всех мелкозерновых зерновых культурах, особенно если по какой-либо причине возникает бесплодие (например, из-за заморозков). Стерильные соцветия имеют тенденцию открываться и, таким образом, становятся более подверженными заражению.Заболевание чаще встречается в прохладном влажном климате.

Значение: Потери урожая обычно невелики, но потери из-за заниженного качества зерна могут быть значительными и происходить во всем мире.

—————————————-

Блэк Пойнт

Alternaria , Helminthosporium и Fusarium spp.

Симптомы: Перикарпии созревающих зерен пшеницы становятся от темно-коричневых до черных, при этом изменение окраски обычно переходит на зародышевый конец ядра (33; 34 — здоровые семена).Если вызвано Alternaria spp., Темный цвет поражает только околоплодник; если он вызван видами Helminthosporium или Fusarium spp., микроб может быть поражен и поврежден или убит. Есть и другие грибы, которые могут вызывать черную точку, но три из них, упомянутые здесь, являются наиболее распространенными.

Развитие: Обычно ядра заражаются этими грибками на стадии теста. Если влажная погода преобладает от нескольких дней до недели непосредственно перед сбором урожая, частота заражения возрастет, и у многих сортов разовьется черная точка.

Хозяев / Распространение: Пшеница — основной хозяин; тритикале и некоторые родственные травы также могут быть поражены. Распространяется по всему миру, везде, где выращивают мелкозерновые злаки.

Значение: Убытки в основном вызваны снижением цен на обесцвеченное зерно; если Fusarium или Helminthosporium spp. вовлечены, жизнеспособность семян также может быть снижена.

—————————————-

Ложная мучнистая роса

Sclerophthora macrospora ( Sclerospora macrospora )

Симптомы: Больные растения обильно побегают; у них короткие, прямые, неправильные или кривые желтовато-зеленые стебли; листья толстые, прямостоячие, обычно в мутовках (35).Культиваторы преждевременно погибают или никогда не опадают. В случае образования головки могут быть разветвленными, а некоторые цветочные ткани превращаются в листоподобные структуры (36).

Развитие: Болезнь зерновых обычно связана с заболоченными или чрезмерно орошаемыми полями. Развитие усиливается, если температура колеблется от 10 до 25 ° C. Заражение может быть инициировано инокулятом в почве или от больных сорняков-хозяев, и для возникновения инфекции должна присутствовать вода. Симптомы наиболее очевидны на стадиях кущения / удлинения стебля растения-хозяина.

Хозяева / распространение: Небольшие локализованные эпидермисы могут возникать при благоприятных условиях. Сообщений о широкомасштабных разрушительных эпидемиях не поступало.

Значение: Небольшие локальные эпидемии могут возникать при благоприятных условиях. Сообщений о широкомасштабных разрушительных эпидемиях не поступало.

—————————————-

Take-All

Gaeumannomyces graminis f.sp. tritici Syn. Ophiobolus graminis

Симптомы: Этот гриб вызывает гниение корней и нижних стеблей. Ткани базального стебля и влагалища листьев, а также корни могут приобретать блестящий черный цвет (37). При осмотре через ручную линзу (10x) темные гифы грибов часто можно обнаружить на подкроновых междоузлиях под старыми влагалищами листьев. Гифы стебля грубые, черные или заметные на корнях. На тяжелое развитие болезни указывают низкорослые растения с побелевшими стеблями и колючками (38).Когда заражение происходит в начале цикла урожая, количество побегов часто уменьшается, а колосья часто остаются бесплодными.

Развитие: Гриб сохраняется на растительных остатках в почве. Первоначальные инфекции возникают в результате контакта с гифами или аскоспорами в почве. Заражение может происходить на протяжении всего цикла урожая, но ему способствуют низкие температуры почвы (12-18 ° C) и щелочные почвы или почвы с дефицитом питательных веществ. Нитраты также, по-видимому, ускоряют развитие болезни. Заражение корней, происходящее осенью и ранней весной, обычно распространяется на ткань кроны и нижние ткани стебля; инфекции, возникающие на более поздних этапах жизненного цикла урожая, причиняют меньший ущерб, поскольку они обычно ограничиваются корнями.

Хозяева / распространение: Универсальный гриб демонстрирует определенную специализацию в отношении пшеницы, тритикале и некоторых родственных трав. Заболевание, по-видимому, ограничено районами выращивания пшеницы с умеренным климатом.

Значение: Подсев широко распространен на монокультурных площадях и, как известно, вызывает значительные потери урожая на озимой пшенице и посеве яровой пшеницы осенью, особенно там, где практикуется известкование или минимальная обработка почвы.

—————————————-

Глазок (соломотряса)

Pseudocercosporella herpotrichoides Syn. Cercosporella herpotrichoides

Симптомы: Наиболее очевидными симптомами этого заболевания являются эллиптические очаги в форме глаз на междоузлиях нижней ножки (39). Поражения окаймлены кольцами от темно-коричневого до зеленовато-коричневого цвета, с соломенной серединой и часто развиваются на влагалище листьев на уровне почвы. Эти поражения могут сливаться и терять отчетливый вид «глазных пятен». При тяжелом развитии болезни стебель или стебель могут сломаться у земли или через повреждение, где стебель ослаблен (40).На корнях не появляются симптомы.

Развитие: Первичное заражение происходит от конидий или мицелия, образующихся на растительных остатках на поверхности почвы или вблизи нее; контакт с развивающимся колеоптилем или прикорневыми участками молодых стеблей обязателен. Грибок ограничивается прикорневыми участками растения. Развитию болезни способствует прохладная влажная погода и высокая влажность почвы.

Хозяева / распространение: Пшеница, тритикале, рожь, овес и другие родственные травы могут быть поражены этим заболеванием, при этом пшеница является наиболее восприимчивой; Чаще повреждаются озимая пшеница и озимая яровая пшеница.Глазные пятна возникают в прохладном влажном климате, где преобладают осенние злаки.

Значение: Глазное пятно может убить отдельные побеги или даже целые растения. Чаще всего потери урожая возникают из-за уменьшения размера и количества ядер, а также из-за полегания.

—————————————-

Острое пятно и корневая гниль ризоктонии

Rhizoctonia solani

Симптомы: Основными симптомами острого пятна являются поражения, которые развиваются на базальных влагалищах листьев; эти поражения аналогичны поражениям, вызываемым Pseudocercosporella herpotrichoides (глазное пятно).Острые очаги поражения более поверхностны и имеют более четкие очертания, чем поражения, характерные для очагов. Края темно-коричневые с бледно-соломенными центрами (41). Мицелий, часто присутствующий в очагах поражения, легко удаляется растиранием. Также могут быть поражены корни, которые обычно приобретают коричневый цвет и уменьшаются в количестве. Заболевание может вызвать задержку роста и сокращение числа побегов.

Развитие: Инфекция сильно зависит от условий окружающей среды.Развитию болезни способствуют сухие песчаные почвы, прохладные температуры и высокая влажность. Гриб сохраняется в почве и растительных остатках, поражает ткани корня и кроны.

Хозяева / распространение: Rhizoctonia solani имеет, пожалуй, самый широкий диапазон хозяев из всех патогенов, поражая большинство возделываемых культур; практически все члены семейства Graminae восприимчивы. Это повсеместный гриб, который присутствует почти везде в почве и растительных остатках.

Значение: Болезнь обычно более серьезна на полях, где постоянно засеваются зерновые, особенно озимая пшеница.Однако ни о каких крупных или широко распространенных эпидемиях не сообщалось.

Обычная корневая гниль, гниль стопы и коронная гниль

Helminthosporium , Fusarium и Pythium spp.

Симптомы: Эти грибы вызывают потемнение или потемнение тканей корня, кроны и базальной стебля. Полегать могут отдельные растения или группы растений. Белые шипы часто видны незадолго до нормальной физиологической зрелости (42).Инфекция на ранних этапах развития культуры может вызвать пред- или послевсходовое «отшелушивание» проростков (43). Поскольку каждый гриб может поражать разные части растения на разных стадиях роста, положительная полевая идентификация возбудителя затруднена.

Развитие: Корни или ткани кроны инфицированы конидиями или мицелием, присутствующими на растительных остатках. Заражению и развитию обычной корневой гнили ( Helminthosporium spp.) Способствуют теплые и сухие почвы, когда растения находятся в состоянии стресса.Гнили корней, ножек и кроны, вызванные Fusarium spp. Обычно предпочитают более прохладные влажные почвы, а влажные почвы предпочитают Pythium spp.

Хозяева / распространение: Эти болезни поражают все основные мелкозерновые злаки, выращиваемые в регионах с умеренным климатом.

Значение: Крупных эпидемий не зарегистрировано. Однако локальные потери могут быть вызваны прореживанием древостоя, уменьшением количества культиваторов, а также уменьшением размера жатки и веса при испытаниях.

—————————————-

Склероциум Уилт (Южный упадок)

Corticum rolfsii ( Sclerotium rolfsii )

Симптомы: Если заражение происходит в начале цикла выращивания, это может привести к до- или послевсходовому «оттиранию» всходов. Больные ткани часто имеют на поверхности белые пушистые грибковые мицелии (44), которые часто проникают в почву, окружающую растение.Последующее развитие болезни приводит к гниению стеблей, крон и корней и, в конечном итоге, к гибели растения; это приводит к появлению «белых колосьев» или шипов на зеленом урожае (45). Склероции обычно обнаруживаются на тканях кроны, стебле или вблизи поверхности почвы (46). Молодые склероции беловатые и с возрастом становятся коричневыми или темно-коричневыми.

Развитие: Sclerotium rolfsii может атаковать растение на любой стадии развития. Мицелий грибов на растительных остатках или склероции служит первичным инокулятом.Заражению и развитию болезней способствуют теплые (20С +) температуры, чрезмерная влажность и кислые почвы.

Хозяева / распространение: Чувствительны большинство злаков и трав, а также многие виды широколистных растений, а гриб широко распространен в тропических и субтропических средах.

Значение: Заболевание редко является проблемой в районах традиционного выращивания пшеницы.

—————————————-

Черная плесень (сажистая плесень)

Alternaria , Cladosporium , Stemphylium , Epicoccum и другие виды.

Симптомы: Типичным симптомом является почерневший вид зрелых или мертвых шипов, вызванный поверхностным накоплением мицелия и спорулирующей грибковой ткани (47).

Развитие: Когда влажная или влажная погода наступает в период созревания урожая или почти сразу же, или когда растения сильно заражены тлей, или когда растения умирают преждевременно, они могут быть заражены одним или несколькими из этих грибов. Технически черная плесень не является заболеванием, поскольку грибы сапрофитны и поражают только мертвые или умирающие ткани растений.

Хозяева / распространение: Черная плесень поражает любые отмершие или умирающие ткани растений; распространение по всему миру.

Значение: Черная плесень, как правило, не имеет экономического значения. Во влажных или дождливых условиях грибы могут проникать в зрелые ядра, вызывая обесцвечивание, появление черных точек или пятен.


Бактериальные возбудители болезней растений представляют собой небольшие одноклеточные палочки длиной от 1 до 3 мкм. У них нет четко выраженного ядра или ядерной мембраны.Бактерии распространяются насекомыми, воздушными потоками, брызгами дождя и механическими средствами. Для инфицирования обычно необходима свободная влага, а проникновение в ткани хозяина происходит через раны или устьичные отверстия. Эти патогены проникают в сосудистую систему или межклеточные пространства в ткани хозяина, а некроз возникает в результате продуцирования токсинов или ферментативной активности бактерий.

—————————————-

Бактериальная черная полова и бактериальная полоса

Xanthomonas campestris pv. translucens Syn. X. translucens , X. translucens flsp. undulosa , X. campestris pv. ундулоза

Симптомы: Черная шелуха и бактериальная полоса вызываются одним и тем же организмом; Локализация и степень симптомов зависят от штамма бактерии, пораженного сорта и условий окружающей среды. «Бактериальная черная полова» встречается в основном на чешуях (48); «Бактериальная полоса» встречается главным образом на листьях и / или листовых влагалищах (49).Первоначальные симптомы — узкие хлоротичные поражения или полосы, пропитанные водой; капли липкого желтоватого экссудата могут появляться при продолжительных периодах дождя или росы (50). Экссудат высыхает, образуя твердые капли или полупрозрачную пленку на поверхности пораженных тканей. Пленка может потрескаться и стать чешуйчатой. Если заражение происходит в начале цикла урожая, колос может быть инфицирован, что приведет к бесплодию; при тяжелом течении болезни могут погибнуть целые листья или колосья.

Развитие: Бактерия может передаваться через семена и сохраняется на растительных остатках в почве, выдерживая как высокие, так и отрицательные температуры.Свободная влага необходима для инфицирования и распространения разорванной ткани эпидермиса. Болезнь распространяется через проливной дождь, контакт с растениями и насекомыми.

Хозяева / распространение: Эти болезни встречаются во всем мире на всех мелкозерновых злаках и многих травах.

Значение: Черная мякина и бактериальная полоса редко вызывают значительный ущерб, хотя часто симптомы могут быть обширными.

—————————————-

Гниль базальной слизистой оболочки и бактериальный ожог листьев

Pseudomonas syringae pv. atrofaciens Syn. Pseudomonas atrofaciens

Симптомы: Могут быть инфицированы листья, стебли и колосья пшеницы и тритикале. Инфекция начинается с небольших темно-зеленых, пропитанных водой очагов, которые становятся от темно-коричневого до черноватого цвета. На колосках поражения обычно начинаются у основания чешуи и в конечном итоге могут распространяться на всю чешуйку (51). Больные чешуйки имеют полупрозрачный вид, если держать их на свету. С возрастом происходит изменение цвета от темно-коричневого до черного.Заболевание может распространиться на позвоночник, а также на ядрах могут развиться поражения (52). Во влажных или влажных условиях может присутствовать беловато-серый бактериальный ил. Инфекции стебля приводят к потемнению стебля; инфекции листьев приводят к небольшим, нерегулярным, пропитанным водой поражениям. Симптомы можно спутать с симптомами других бактериальных заболеваний, генетического меланизма (ложная черная половинка), пятнистости septoria nodorum (пятнистость чешуи) и повреждения от мороза.

Развитие: Патогены выживают на растительных остатках, а также на различных травах-хозяевах.Он распространяется проливным дождем или насекомыми, а также может передаваться через семена.

Хозяева / распространение: Болезнь может поражать все мелкие зерновые культуры; распространение по всему миру.

Значение: Гниль базальной чешуи обычно не имеет экономического значения, но часто регистрируется во влажных районах выращивания зерновых.

—————————————-

Бактериальная гниль (желтая гниль ушей)

Corynebacterium tritici

Симптомы: Желтый экссудат на шипах указывает на бактериальный ожог.В сухом виде экссудат белого цвета. Часто шипы и шейки выглядят как деформированная липкая масса (53). Ранние листья также могут быть морщинистыми или скрученными. Эта бактерия связана с нематодой Anguina tritici в некоторых регионах.

Развитие: Бактерии сохраняются в органическом материале почвы. Он поражает пшеницу при контакте с верхушкой растения в мутовке листа, и этой передаче часто способствует нематода A.tritici .

Хозяева / распространение: Пшеница — единственный культивируемый хозяин, хотя некоторые дикие травы восприимчивы к атаке. Заболевание часто встречается на Азиатском субконтиненте.

Значение: Бактериальный грибок не имеет экономического значения.


Вирусы — это самые мелкие патогены, представленные в этом полевом руководстве, и обсуждается только одно вирусное заболевание (BYD). Инфекционная вирусная частица называется вирионом, который представляет собой стабильную, не размножающуюся стадию, на которой вирус передается от одного растения к другому.Вирусы размножаются в растении-хозяине, и передача может происходить несколькими способами: насекомыми и клещами (особенно сосущими насекомыми, такими как тля), нематодами, семенами, пыльцой, грибами, почвой и механическим путем.

Вирусные заболевания часто трудно обнаружить, потому что инфицированные хозяева могут не проявлять видимых симптомов или симптомы могут очень напоминать симптомы различных физиологических нарушений или генетических аномалий. Идентификацию можно облегчить путем определения присутствующих векторов и диапазона хозяев; во многих случаях для положительной идентификации требуется использование электронного микроскопа и серологических методов.

—————————————-

Ячмень желтый карлик

Симптомы: Симптомы желтого карлика ячменя (BYD) различаются в зависимости от сорта пораженной культуры, возраста растения на момент заражения, штамма вируса и условий окружающей среды. Симптомы часто маскируются или путаются с другими проблемами. У пораженных растений наблюдается пожелтение (54) или покраснение (на овсе и некоторых видах пшеницы) листьев, задержка роста, вертикальное положение утолщенных жестких листьев (55), снижение роста корней, задержка (или отсутствие) колошения и снижение урожайности.Кочаны пораженных растений, как правило, остаются прямостоячими, становятся черными и обесцвечиваются во время созревания из-за колонизации сапрофитными грибами.

Развитие: Температура около 20 ° C благоприятна для развития болезни, и симптомы появляются примерно через 14 дней после заражения.

Векторы / Хозяева / Распространение: Термин вирус желтой карликовости ячменя (BYDV) включает несколько родственных вирусов, которые все передаются тлей.Переносчиками могут выступать более 20 видов тлей. BYD, вероятно, является наиболее распространенным вирусным заболеванием зерновых в мире. Он поражает не только пшеницу, но и ячмень, тритикале, овес и многие другие виды трав.

Значение: Инфекции, возникающие на ранней стадии цикла урожая, могут привести к потере урожая более чем на 20%, при этом были зарегистрированы гораздо более крупные потери.


Пшеница и тритикале могут быть поражены множеством насекомых.К счастью, только несколько видов насекомых имеют большое значение, нанося серьезный ущерб обширным географическим районам; большинство видов являются лишь случайными вредителями и / или географически не широко распространены. «Вредный статус» многих видов не всегда хорошо задокументирован.

—————————————-

Тля (разные виды)

Симптомы: Тля — почти прозрачные мягкотелые сосущие насекомые (56).При наличии достаточного количества тля может вызвать пожелтение и преждевременную гибель листьев. Из них выделяются капли сладкой жидкости, известной как «медвяная роса», которая может вызвать крошечные ожоги на листве и, как правило, способствовать развитию заросшей сажей плесени. Питание Schizaphis graminin (57) особенно вредно, приводя к развитию некротических участков, иногда сопровождающихся багровостью и скручиванием зараженных листьев. Кормление Diuraphis noxis приводит к появлению длинных белых полос на листьях (58), скручиванию листьев, развитию пострейтинга и стерильным головкам.

Жизненный цикл: Жизненный цикл тлей включает крылатые (крылатые), бескрылые (бескрылые), половые и бесполые формы. Питаясь злаками, самки большинства видов тлей размножаются бесполым путем (без оплодотворения), давая имфу, а не яйца.

Хозяева / распространение: Виды, обычно встречающиеся на злаках во всем мире, включают:

  • Rhopalosiphum padi (черемуха-овсяная тля)
  • Schizaphis graminum (зеленый жук)
  • р.maidis (кукурузная тля)
  • Metopoliphium dirhodum (розовая тля)
  • Sitobion avenae (английская зерновая тля)
  • Diuraphis noxis (Русская пшеничная тля)

Значение: Тля — важный и широко распространенный вредитель зерновых культур. При кормлении в достаточном количестве они могут нанести значительный ущерб. Кроме того, перечисленные выше виды могут действовать как переносчики вируса желтой карликовости ячменя.

—————————————-

Жуки-вонючки (разные виды)

Симптомы: Взрослые клопы-вонючки питаются тканью стебля или развивающимися ядрами (59). Слюна этого насекомого токсична для растения, и один кормовой прокол может убить стебель. Кормление зернами на стадии молочного теста разрушит ядро, тогда как кормление на более поздних стадиях развития сильно сморщит зерно. Питание развивающейся головкой может вызвать частичное или полное бесплодие.Взрослые клопы-вонючки имеют тело в форме щита (60) и при раздавливании издают неприятный запах.

Жизненный цикл: Вонючие клопы зимуют во взрослом возрасте и могут диапаузоваться. Они склонны впадать в спячку под мертвыми листьями и травой. Весной они мигрируют к злаковым хозяевам, спариваются и откладывают яйца в различных местах растения. Из них вылупляются нимфы, которые питаются растением. Мягкие зимы и малое количество осадков способствуют появлению насекомых.

Хозяева / распространение: Вонючие насекомые питаются большинством злаков и трав, а также большим количеством сорняков (в зависимости от вида).Жуки-вонючки имеют большое экономическое значение в Малой Азии.

Значение: Потери из-за вонючих насекомых сильно различаются и зависят от плотности насекомых, погодных условий и продолжительности вегетационного периода урожая. Потери в основном связаны с ухудшением качества выпечки.

—————————————-

совки, совки и стеблевики (разные виды)

Симптомы: Первичный симптом — дефолиация растения.Личинки питаются листьями, пережевывая их от краев к средней жилке, или головками злаковых растений. Тяжелые инвазии могут быть очень разрушительными; личинки могут забраться на растение и перерезать шею чуть ниже головы. Некоторые виды могут питаться на поверхности почвы, другие — под землей, питаясь корнями, а третьи — внутри стебля.

Жизненный цикл: Взрослые совки (61) и армейские черви (62) — это бабочки, а самки откладывают яйца на листьях и кожухах листьев у земли.Эти яйца вылупляются в течение нескольких дней, и сначала личинки (63, совка; 64, совка) кормятся недалеко от того места, где они вылупляются. Днем личинки находят в трещинах в почве или под камнями, кормятся ночью или рано утром. В сырую погоду они могут кормиться весь день.

Хозяева / Распространение: Личинки, как правило, всеядны в атаке на травы. Виды этих насекомых встречаются в большинстве районов мира, где выращивают зерновые.

Значение: Совки и совки спорадически вызывают серьезные повреждения; когда они это сделают, они могут опустошить большие территории.

—————————————-

Зерновой листоед

Улема меланопа

Симптомы: Взрослые жуки имеют длину 4-5 мм, черную голову, светло-коричневую грудную клетку и блестящий сине-зеленый покров крыльев с параллельными линиями маленьких точек (65). Личинки имеют тусклый или ярко-желтый цвет, но вскоре приобретают вид слизистой, шаровидной черной массы из-за скопления фекального материала, который они производят и накапливают на спине (66; 67).Наиболее ярким признаком заражения листоедами злаковых культур являются отчетливые продольные полосы на листьях (68); эти полосы образуются при кормлении взрослых жуков и личинок.

Жизненный цикл: Насекомое производит одно поколение в год. Взрослые особи начинают свою питательную деятельность весной. Они откладывают желтые яйца поодиночке или небольшими цепочками, покрывая их липкой пленкой, которую почва и взрослые особи появляются летом. Зимуют взрослые особи под растительными остатками на поверхности почвы, в чехлах и початках кукурузы на корню или под корой деревьев.

Хозяева / распространение: Зерновые листоеды могут быть проблемой для осенних зерновых культур. Меньше поражается пшеница с опушенными листьями.

Значение: Значительные потери урожая могут возникнуть у озимой пшеницы и яровой пшеницы осеннего посева. Потери урожая от 14% до более чем 25% произошли из-за естественного заражения.

—————————————-

Трипсы (разные виды)

Симптомы: Трипсы — маленькие (1 мм в длину) насекомые коричневого или черного цвета с сужающимся сегментированным брюшком.У них есть колющий и сосущий ротовой аппарат и обычно две пары узких крыльев. Обычно они находятся за оболочкой флагового листа, питаясь стеблем (69). Однако могут быть поражены листья, стебли и кочаны. И взрослые, и нимфы могут вызывать повреждения и, если присутствуют в большом количестве, могут вызывать серебристую окраску тканей, которыми они питаются.

Жизненный цикл: Яйца вставляются в ткань хозяина или прикрепляются к ней. Время генерации очень короткое, и может быть 10 и более поколений в год.Сильные дожди обычно уничтожают большую часть населения.

Хозяин / Распространение: Некоторые виды трипсов живут исключительно на злаках, а также на кормовых или сорных травах.

Важность: Трипсы редко вызывают серьезные повреждения, и редко встречаются заражения на таком уровне, который требует контроля.

—————————————-

Гессен Флай

Деструктор Mayetiola

Симптомы: Сильные заражения гессенскими мухами приводят к задержке роста растений, появлению тонких насаждений, полеганию и снижению урожайности.Травмы полностью вызваны личинками, которые высасывают соки из тканей растений (70). Если заражение происходит во время соединения, зараженные стебли часто ломаются до созревания. Гессенская муха имеет длину 3-4 мм, черные голова и грудь, брюшко розоватое или желто-коричневое.

Жизненный цикл: Взрослые мухи появляются весной из куколок, перезимовавших на соломе или стерне. Крошечные продолговатые яйца красноватого цвета и откладываются рядами на верхних сторонах листьев.Яйца вылупляются в течение одной недели; белые безногие личинки поселяются за влагалищами листьев и высасывают сок растения. Они превращаются в полупрозрачных бледно-зеленых личинок, похожих на слизняков. Красновато-коричневые куколки, обычно называемые «семенами флага» из-за их сходства с семенами льна, имеют овальную форму, приплюснутые, сужающиеся к концу и имеют длину 3-5 мм. Они находятся за влагалищами листьев, обычно в узле.

Хозяева / распространение: Гессенская муха — в основном вредитель пшеницы, но может поражать ячмень, рожь и другие травы.Этот вредитель был зарегистрирован в большинстве регионов мира, где выращивают пшеницу.

Значение: Это одно из самых разрушительных насекомых-вредителей зерновых культур. Произошли широко распространенные вспышки, и в некоторых местах (например, в Северной Африке и США) прошлые вспышки повторяются ежегодно.

—————————————-

Личинка на стебле пшеницы

Meromyze Американа

Симптомы: Когда молодые побеги поражаются осенью или ранней весной, они обычно погибают; Зараженные растения демонстрируют состояние «белой головы», обычно вызываемое насекомыми, сверлящими стебель (71).Взрослые мухи имеют длину около 6 мм, от бледно-зеленого до желтого цвета с темными полосами.

Жизненный цикл: Личинки стеблевой личинки пшеницы зимуют на злаковых или злаковых травах (72). Самки откладывают маленькие белые яйца, по одному на стебель, около ножен флагового листа; личинки зарываются внутрь стебля и поедают его, убивая верхнюю часть стебля и голову. Обычно бывает три поколения в год; один весной, один летом и третий ранней осенью, которые зимуют в виде личинок.

Хозяева / распространение: Помимо пшеницы, к растениям-хозяевам относятся рожь, ячмень и другие травы. В разных частях света есть ряд других мух, которые нападают на пшеницу аналогичным образом и наносят такой же ущерб.

Значение: На зараженных полях 10-15% растений могут быть повреждены. В некоторые годы повреждения могут быть серьезными, но это насекомое редко вызывает массовые повреждения. Однако сильное заражение отдельных насаждений пшеницы может убить значительную часть побегов.

—————————————-

Пилильщик

Цефус cinctus

Симптомы: Повреждение пилильщиками включает преждевременное пожелтение кочана и сморщивание зерна. Личинки опоясывают стебель (73), и на более поздних этапах цикла урожая полегание является обычным явлением.

Жизненный цикл: Пилильщики производят одно поколение в год. Зимуют личинки в соломе (74); весной окукливаются.Взрослые пилильщики — маленькие, похожие на мух осы, появляются с конца весны до середины лета. Самки откладывают маленькие белые яйца в верхних узлах стеблей чуть ниже головы. После вылупления безногие белые личинки проникают в стебель и туннелируют вниз, питаясь сердцевиной стебля. Закончив кормление, они спускаются дальше и опоясывают основание стебля.

Хозяева / распространение: Практически все культурные злаки и местные травы выступают в качестве хозяев, хотя предпочтительнее пшеница.Чаще поражаются осенние зерновые культуры. Линии пшеницы с твердыми или частично твердыми стеблями гораздо менее восприимчивы к атакам. Пшеничный стеблевой пилильщик — серьезная проблема в Средиземноморском бассейне.

Значение: Пилильщики в некоторые годы могут причинить значительный ущерб, но заражения обычно носят непостоянный характер.

—————————————-

Белые личинки (разные виды)

Симптомы: Белые личинки могут частично или полностью отрезать корни растений-хозяев.Это вызывает появление пятен увядания и отмирания растений пшеницы (особенно на стадии проростков) — симптомы, которые можно отнести к корневым гнилям. Однако при обнаружении низкорослых участков необходимо проверить окружающую почву на наличие личинок (75). В зрелом возрасте самая крупная из этих личинок может достигать нескольких сантиметров в длину и почти одного сантиметра в толщину. У личинок на грудной клетке три пары ног (76).

Жизненный цикл: Белые личинки — личинки майских или июньских жуков.Яйца откладываются в почве, а вылупившиеся личинки питаются корнями. Продолжительность личиночной стадии варьируется от вида к виду.

Хозяева / распространение: Многие виды белых личинок, встречающиеся во всем мире, могут поражать пшеницу и многие другие виды растений. Зерновые культуры могут понести значительный ущерб, если их посеять на сильно зараженных лугах.

Значение: Если корни не уничтожены полностью, растения могут выжить, но они отстают в росте и не дают кочанов.Однако распространение и степень атаки неодинаковы.

—————————————-

Проволочники (разные виды)

Симптомы: Повреждения проволочником очень похожи на повреждения, вызываемые другими жевательными насекомыми, обитающими в почве; Единственный надежный способ идентифицировать проволочников как возбудителя болезни — найти их вместе с поврежденными сеянцами (77). Название «проволочник» относится к жесткому, похожему на проволоку внешнему виду личинок.Они имеют длину 20-30 мм и часто бывают гладкими, твердыми и хорошо отполированными. У них три пары ног (78), и их цвет может варьироваться от насыщенного кремового до оттенков коричневого. Личинки проволочника могут атаковать пшеницу сразу после посева, поедая эндосперм зерен и оставляя только оболочку семян. Распространенным признаком нападения червя является увядание и / или отмирание ряда соседних растений в ряду или на участке. Стебли пораженных сеянцев пережевывают прямо над семенами.

Жизненный цикл: Проволочники — личинки жуков-щелкунов, которых существует множество видов.Взрослые жуки (79) откладывают яйца в почву, обычно весной, и личинкам может потребоваться несколько лет для развития до окукливания, в зависимости от вида. Поколения пересекаются, так что личинки всех стадий и размеров могут быть обнаружены в почве одновременно.

Хозяева / распространение: Многие виды проволочников встречаются по всему миру, и все они могут поражать пшеницу. Эти личинки способны атаковать и многие виды растений.

Значение: Верельефные черви являются одними из самых вредных насекомых, поражающих почву.Ущерб обычно бывает наиболее серьезным, если пшеница была посеяна после пара или после нескольких лет посева травы.

—————————————-

Слизни, улитки, кузнечики и сверчки (разные виды)

Симптомы: Слизни и улитки (80) могут питаться эндоспермом прорастающих семян, откусывать проростки на уровне земли и поедать старые растения, пережевывая продольные полосы на листьях (81). Это придает взрослому растению потрепанный вид.Кузнечики (82) и сверчки наносят урон, очень похожий на тот, который наносят совки и совки.

Хозяева / Распространение: Все эти насекомые атакуют широкий спектр видов растений, включая злаки. Распространение по всему миру.

Значение: Эти насекомые обычно локализованы в местах своего распространения, но могут нанести значительный ущерб отдельным насаждениям пшеницы.

—————————————-

Клещи (разные виды)

Симптомы: Взрослые клещи обычно имеют длину менее 1 мм, и у большинства видов, населяющих растения, есть сосущие части рта.Клещи — не насекомые. Взрослые особи обычно обладают четырьмя парами ног (83), а личинки — только тремя парами. Однако у пшеничного клеща завитка, Eriophye tulipae (син. Aceria tulipae ), всего две пары ног. Когда клещи присутствуют в большом количестве, они вызывают появление серебристых пятен на листьях (84). Некоторые виды могут образовывать паутину и / или могут вызывать сильную задержку роста зараженных растений, плохую головку и побеление. Отдельные клещи настолько малы, что их трудно увидеть невооруженным глазом.Даже в этом случае, если подержать зараженный лист над листом белой бумаги (сложить его в виде желоба) и несколько раз резко постучать, сотни клещей упадут на бумагу и будут видно, как они передвигаются.

Хозяева / распространение: Клещи, как правило, не представляют серьезной проблемы, за исключением клеща завитка пшеницы, который является переносчиком вируса мозаики полос пшеницы (WSMV).


Нематоды, также известные как немы или угри, представляют собой несегментированные круглые черви, которые в большом количестве населяют почву и воду.Некоторые виды паразитируют на растениях. Все нематоды развиваются из яиц и проходят череду личиночных стадий (обычно четыре) до достижения взрослой жизни. Размножение может быть половым или партеногенным. Нематоды распространены в почве, проточной воде и частях растений. У некоторых видов есть стадия покоя, которая выдерживает высыхание.

Питание нематод снижает жизнеспособность растений и вызывает поражения, гнили, деформацию, образование желчных и корневых узлов. Зараженные поля выглядят неровными, обычно с отчетливыми участками низкорослых растений.

—————————————-

Галловая нематода (пшеничная нематода или молочница)

Ангина tritici

Симптомы: Искаженные листья и стебли очевидны до колошения. По мере того, как больные растения достигают зрелости, в цветках образуются галлы, заменяющие ядра (85). Галлы похожи по форме на семена, которые они заменяют, и имеют темно-коричневый цвет (86).Внутри галлов присутствует большое количество подвижных личинок, которые становятся активными после увлажнения галлов. Эти нематоды могут действовать как переносчики Corynebacterium tritici .

Развитие: Галлы рассыпаются вместе с семенами во время посева и сбора урожая. Во влажной почве из семенных галлов выделяются тысячи личинок. Влажная погода способствует перемещению личинок и процессу заражения. Нематода проникает в коронку и основание стебля, в конце концов проникая в цветочные зачатки.Там они созревают и откладывают большое количество яиц. Семенные галлы развиваются в недифференцированных тканях цветка.

Хозяева / распространение: Семенная галловая нематода паразитирует на пшенице, тритикале, ржи и родственных травах; в первую очередь поражает пшеницу. Он встречается на Ближнем и Среднем Востоке, в Азиатском субконтиненте, в Восточной Европе и иногда в Северной Америке.

Значение: Эта нематода редко имеет экономическое значение.

—————————————-

Нематода кисты злаков

Heterodera avenae

Симптомы: Цистообразные нематоды злаков легче обнаруживаются на проростках, чем на взрослых растениях.В корнях зараженных растений появляются частые разветвления (87) и вздутия (цисты). Кисты в молодом возрасте не совсем белые, а с возрастом становятся темно-коричневыми. Сеянцы, ослабленные нематодами, часто поражаются почвенными патогенами, особенно корневой и кроновой гнилями.

Развитие: Личинки во влажной почве проникают в корни около точки роста и вырастают во взрослых особей. По мере созревания нематод происходит увеличение клеток, набухание корней и ветвление корней. Цисты образуются по мере того, как нематоды продолжают развиваться во взрослых особей, производящих яйца.

Хозяева / распространение: Большинство зерновых культур и родственных видов могут быть поражены нематодами цист злаков. Они встречаются в большинстве регионов мира, где выращивают зерновые, особенно на новых возделываемых территориях, которые ранее были пастбищами.

Значение: Значительные потери урожая могут произойти, когда популяции нематод высоки. Чувствительны все сорта пшеницы, но некоторые не поддерживают образование кист.

—————————————-

Нематода корневого узла

Meloidogyne spp.

Симптомы: Для заражения нематодами корневых узлов характерно образование небольших узелков или галлов возле кончиков корней. Над землей пораженные растения низкорослые и хлоротичные. Иногда наблюдается чрезмерное ветвление пораженных корней (88).

Развитие: Нематоды корневых узлов обычно поражают растения весной или в начале лета. Каждый корневой узел содержит одну или несколько самок, которые производят большие массы яиц в своих мешковидных телах.К середине лета яйца выдавливаются, и нематоды перезимовывают в виде яиц. Обычно в год бывает одно поколение.

Хозяева / распространение: У корневых нематод очень широкий круг хозяев, включая все мелкозерновые злаки. Meloidogyne naasi, по-видимому, специфичен для злаков и трав, и его можно найти везде, где выращиваются злаки.

Значение: Ущерб, наносимый нематодами корневых узлов, зависит от количества яичных масс в почве.Все сорта озимой и яровой пшеницы кажутся совместимыми хозяевами нематоды. Недостаток питательных веществ, плохой дренаж и почвенные заболевания могут скрыть присутствие нематод.


Аномальное развитие растений может быть связано с физиологическими или генетическими нарушениями, дефицитом питательных веществ, стрессами и раздражителями окружающей среды. Физиологические пятна на листьях, пятна и хлороз листьев могут возникать по многим причинам. Некоторые формы хлоротичных полос, пятен и некроза наследуются генетически (например, хлоротичные пятна и коричневый некроз) в результате хромосомной нестабильности или определенных нежизнеспособных генетических комбинаций (гибридный некроз).У генотипов появляются пятнистости и внешний вид пятен.

—————————————-

Физиологическая пятнистость на листьях

Симптомы: Если патоген не может быть идентифицирован как причина пятнистости листьев (89), симптом может быть вызван физиологическим расстройством или недостатком минералов (например, дефицитом марганца).

Разработка: «Пятно» озимой хлебной пшеницы и твердой пшеницы зарегистрировано как физиологическая пятнистость на листьях; пятна начинают появляться во время колошения и увеличиваются в размере и количестве к верхушке растения.В остальном пятнистые растения нормальны. Пятна на листьях могут также возникать, когда прохладная, пасмурная и влажная погода сменяется жаркой солнечной погодой или в результате сильных колебаний температуры.

Хозяева / распространение: Возникновение физиологических пятен на листьях связано с разнообразием и его взаимодействием с окружающей средой.

Важность: Обычно не представляет серьезной проблемы; постоянные селекционные работы направлены на устранение генотипов, склонных к пятнам.

—————————————-

Меланизм и коричневый некроз (ложная черная мякина)

Симптомы: Меланизм проявляется в виде коричневато-черных или темно-пурпурных пятен, полос или пятен на листовой оболочке, стеблях (90) и / или чешуях и является результатом высокой продукции меланоидных пигментов у некоторых генотипов. Темно-коричневая пигментация обычно развивается на чешуях (91) и цветоножках. Меланизм и коричневый некроз можно спутать с бактериальной черной шелухой или пятнистостью септориоза.

Развитие: Симптомы развиваются при определенных условиях окружающей среды, в частности, в пасмурную влажную погоду и при высокой интенсивности ультрафиолетового излучения (на большой высоте). По-видимому, меланизм связан с генами устойчивости к стеблевой ржавчине из «Hope» и h54.

Хозяева / распространение: Меланизм возникает везде, где выращивается пшеница, но более выражен в условиях высокой радиации и высокой влажности.

Важность: В общем, не серьезная проблема; у некоторых крестов наблюдается серьезный некроз, что снижает урожайность.

—————————————-

Генетический флекинг

Симптомы: Многочисленные заболевания вызывают хлоротичную пятнистость, но «самовозбуждение» или генетически контролируемое пятнистость — обычное явление для мелких зерновых злаков. Пятна могут варьироваться от маленьких точечных до больших пятен (92). В некоторых случаях листья могут быть бледно-зеленого цвета, что может быть генетическим признаком низкого содержания хлорофилла.

Развитие: Генетическая пятнистость или пятнистость могут развиться в любой момент цикла урожая, но более очевидны на более поздних стадиях развития растений (особенно у яровой пшеницы).

Хозяева / Распространение: Встречается во многих генотипах пшеницы.

Значение: Генетическая пятнистость не обязательно делает генотип пшеницы непригодным для выращивания. Некоторые коммерческие сорта пшеницы обладают высоким потенциалом урожайности и были выпущены, несмотря на генетическую пятнистость.

—————————————-

Гибридный некроз (скопление карликов)

Некоторые формы пятнистости и некроза возникают в результате хромосомной нестабильности или генетических аберраций; эти нарушения известны как гибридный некроз.У пораженных растений наблюдается разная степень некроза (93), часто связанная с задержкой роста или скоплением карликов. Гибридный некроз обычно наблюдается в материале раннего поколения (94), и пораженное потомство уничтожается.


Плохой рост растений часто можно объяснить недостаточным уровнем основных питательных веществ для растений. Азот, фосфор и калий используются растением в относительно больших количествах и поэтому являются наиболее часто дефицитными питательными веществами.Однако может возникнуть и дефицит питательных микроэлементов. Многие минералы в почве слишком высоки. Накопление солей в почве, недостаточное количество воды, экстремальные температуры и неправильное применение пестицидов также могут повлиять на рост и урожайность сельскохозяйственных культур.

—————————————-

Недостаток азота, фосфора и калия

Пшеница с дефицитом азота выглядит бледно-зеленой (95), а нижние листья становятся желтыми, обычно от кончика до ножен, с последующим некрозом, если дефицит сохраняется.Дефицит азота — наиболее распространенный и широко распространенный дефицит питательных веществ в мелком зерне.

Дефицит фосфора обычно приводит к низкорослым растениям с меньшим количеством побегов (96), если дефицит легкий. При сильном дефиците листья часто становятся бледными или желтовато-красными, начиная с нижних и заканчивая кончиками листьев внутрь. Пораженная ткань может стать коричневой и, в случае серьезного дефицита, в конечном итоге погибнет. Зеленые части листьев могут быть голубовато-зелеными, а основание стеблей пурпурным.Развитие маленьких головок также является частым симптомом.

Дефицит калия бывает трудно обнаружить, а потеря урожая может произойти задолго до появления визуальных симптомов. Сильный дефицит приведет к укорачиванию междоузлий, а кончики и края нижних листьев станут сухими и опаленными.

—————————————-

Незначительные недостатки элементов

Maganese Дефицит вызывает появление сероватых некротических пятен или полос на прикорневой части новейших листьев.Некротические пятна могут распространяться на лезвие, вызывая перекручивание или скручивание верхней части листа (97). Дефицит марганца чаще всего встречается в почвах, имеющих значение. Овес более чувствителен, чем другие мелкозерновые виды. Некорневая подкормка сульфатом марганца может облегчить этот дефицит.

Симптомы дефицита меди включают обесцвечивание кончиков молодых листьев с последующим разрывом и скручиванием листьев (98). Также растение может давать отбеленные и стерильные колосья.Часто шип не выходит из стебля должным образом.

—————————————-

Токсичность алюминия

Симптомы: Высокая концентрация алюминия сначала замедляет развитие корней, делая их коренастыми. Они часто имеют коричневатый цвет. Типичными симптомами в надземной части растения являются мелкие листья, укороченные и утолщенные междоузлия (99). Также часто бывает, что кончики листьев отмирают, а старые листья становятся желтыми и ломкими.

Разработка: Эта токсичность связана с низким pH почвы, и ее можно снизить путем ограничения.

Хозяева / Распространение: Хотя многие минералы могут быть токсичными для растений, наиболее распространенная токсичность, влияющая на пшеницу, вызвана избытком свободного алюминия. Существует общая вариабельность толерантности к алюминию в хлебной пшенице и тритикале (100).

Значение: На больших площадях потенциально продуктивных земель с кислыми почвами (низкий pH) есть токсичные уровни свободного алюминия.

—————————————-

Солевой стресс

Симптомы: Концентрация соли в поле редко бывает однородной; таким образом, одним из первых симптомов, указывающих на проблему соли, является изменчивость роста сельскохозяйственных культур на поле (бесплодные пятна — не редкость) (101). Растения, страдающие от солевого стресса, низкорослые, имеют темно-сине-зеленый цвет, с ожогами на кончиках и краями листьев. Тест почвы может быстро подтвердить, является ли уровень соли в почве чрезмерным.

Хозяева / распространение: Поражаются все мелкие зерна, но ячмень более устойчив к высоким уровням соли, чем другие мелкозерновые виды.

Значение: В некоторых районах уровень соли в почве долгое время ограничивал урожайность; на некоторых плохо осушаемых орошаемых землях пшеницы накапливается соль, что в конечном итоге ограничивает урожайность.

—————————————-

Влажное напряжение

Симптомы: Стресс из-за влажности в начале цикла урожая приведет к задержке роста растений и уменьшению кущения и развития корней.Скручивание и скручивание листьев в полдень также являются симптомами недостатка влаги (102). Воздействие влаги во время развития колоса может уменьшить количество колосков и цветков, а сильное воздействие может привести к сморщиванию зерна. Другие критические периоды возникают при поздней загрузке и во время набора семян. Сильный водный стресс в эти периоды может вызвать полное или частичное бесплодие.

Распространение: Влажный стресс в некоторой степени возникает каждый год в большинстве богарных сред.

Значение: Урожайность часто снижается без появления явных визуальных симптомов.

—————————————-

Тепловое напряжение

Симптомы: Воздействие высоких температур часто связано с воздействием стресса из-за влаги, и симптомы трудно разделить (103). Умеренно высокие температуры ускоряют развитие растений и снижают скорость их роста.Количество и образование колосков и цветков, а также наполнение зерна уменьшаются, что приводит к снижению урожайности. Стадии поздней заделки и завязывания семян особенно уязвимы, и во многих регионах более высокая вероятность возникновения высоких температур на этих более поздних стадиях развития растений. Очень высокие температуры убивают растения, денатурируя белки.

Значение: Во многих регионах период от цветения до созревания пшеницы совпадает с началом жаркой и засушливой погоды.Если наряду с высокими температурами возникают иссушающие ветры, урожайность может значительно снизиться.

—————————————-

Повреждения гербицидами

Симптомы: Фитотоксичность может быть результатом неправильного применения большинства пестицидов. Применение таких гормональных гербицидов, как 2,4-D, слишком рано в цикле урожая может вызвать скручивание листьев и деформацию колосьев (104); применение возле цветков может вызвать бесплодие.Остатки от внесения триазинов (таких как атразин) в урожай, предшествующий пшенице, могут отрицательно повлиять на рост пшеницы (105); симптомы — обесцвечивание листьев с последующим некрозом (106).

Развитие: Повреждение происходит, когда химические вещества применяются в чрезмерных количествах, на неправильной стадии роста или на неправильных видах.

Значение: У мелкозерновых злаков обычно ограниченный ущерб; деформации редко приводят к значительным потерям.

—————————————-

Урон от мороза

Симптомы: Хлороз пораженных тканей — частый симптом. Легкий мороз может затронуть только новую ткань, в результате чего на листьях или шипах появятся полосы или полосы. Сильный мороз убивает пораженные ткани, которые приобретают обесцвеченный белый цвет (107). Бесплодие может быть результатом заморозков во время цветения (108). Эпидермис плодоножки часто отделяется от подлежащей ткани.

Разработка: Замораживание тканей растений может происходить на любой стадии цикла урожая. Молодые или недавно появившиеся ткани наиболее подвержены повреждению. Цветущие части особенно чувствительны.

Хозяева / распространение: Все растения могут пострадать от заморозков, а заморозки могут возникать в большинстве регионов с умеренным климатом, выращивающих пшеницу.

Значение: Мороз может стать серьезной проблемой, если он возникает в конце цикла урожая.


Альтернативный хозяин Второй вид хозяина, необходимый для некоторых видов ржавчины.
                         и другие организмы, чтобы завершить свою жизнь
                         цикл.

Хлороз пожелтение или побеление нормально зеленых растений
                         ткань.

Coalesce Объединяться, сливаться или объединяться.

Конидиофор Нитевидный стебель, на котором конидии (споры)
                         производятся.Конидиум Любая бесполая спора, образующаяся на конидиофоре.
(мн. конидии)

Диапауза Период покоя

Экссудат Гелеобразное скопление спор или
                         бактериальный ил.

Гниль стопы Симптомы болезни, такие как обесцвечивание,
                         некроз и гниение, поражающие корни
                         и базальные части растения или стебля.

Галл Локализованное разрастание растения или
                         ткань паразита, которая производит аномальный
                         рост или припухлость, обычно вызванные
                         патогенные организмы, нематоды или
                         насекомые.Медовая роса липкий экссудат (содержащий конидиалы)
                         произведенный на одном этапе жизни
                         цикл  Claviceps purpurea .

Гифа Трубчатое нитевидное волокно грибковой
(pl. hyphae) мицелий.

Иммунный Не подвержен патогенам.

Инокулят Споры или другой больной материал, который
                         может вызвать инфекцию.Поражение Видимая область пораженной ткани на
                         зараженное растение.

Мозаика Рисунок с отображением симптомов болезни.
                         смешанные зеленые и более светлые пятна.

Мицелий Масса гиф, образующих тело
(мн. мицелий) грибок.

Некроз Отмирание растительной ткани, обычно
                         сопровождается обесцвечиванием.Патоген Микроорганизм, вызывающий заболевание.

Первичные споры или фрагменты мицелия
посевной материал, способный вызвать заболевание.

Пустула Споровая масса, развивающаяся ниже
                         эпидермиса, обычно пробиваясь на
                         зрелость.

Устойчивость Собственная способность растения-хозяина к
                         предотвратить или замедлить развитие
                         инфекционное заболевание.Склероций Плотная компактная мицелиальная масса, способная
(pl. sclerotia) оставшихся в спящем состоянии для продолжительного
                         периоды.

Старение Продолжающаяся фаза роста растений.
                         от полной зрелости до смерти.

Спора Мельчайшая репродуктивная единица у грибов и
                         низшие формы растений.

Спороношение Период активного образования спор.Полосатая полоса Отображение узких параллельных полос или
                         группы.

Восприимчивые существа, подверженные инфекции или травмам
                         возбудитель; неиммунный.

Симптом Видимая реакция растения-хозяина на
                         патогенный организм.

Telium Postule, содержащий телиоспоры.
(пл. телия)

Телиоспора Толстостенная покоящаяся спора, производимая
                         ржавчина и головня грибки.Толерантность Способность растения-хозяина развиваться
                         и воспроизводятся достаточно эффективно, пока
                         поддерживая болезнь.

Передача Распространение возбудителя болезни среди
                         отдельные хосты.

Уредиоспора Бесполая спора ржавчинных грибов.

Вектор Организм, способный передавать
                         посевной материал.

Вирулентность Относительная способность микроорганизма
                         чтобы преодолеть сопротивление хозяина.Пропитанный водой Кажется влажным, затемненным и частично
                         прозрачный.
 

Стеблевая ржавчина пшеницы

Schumann, G.L. and K.J. Леонард. 2000. Стеблевая ржавчина пшеницы (черная ржавчина). Инструктор по охране здоровья растений . DOI: 10.1094 / PHI-I-2000-0721-01
Обновлено 2011 г. .

Стеблевая ржавчина (черная ржавчина)

Puccinia graminis f. sp. tritici

Пшеница и ячмень, барбарис обыкновенный (и еще несколько видов Berberis , Mahoberberis и Mahonia spp.)

Авторы
Гейл Л. Шуман , Массачусетский университет, Амхерст
Курт Леонард , Министерство сельского хозяйства США,
Служба сельскохозяйственных исследований, Лаборатория зерновых болезней, Сент-Пол, Миннесота


Урединия Puccinia graminis f. sp. tritici

Стеблевая ржавчина когда-то была самым опасным заболеванием зерновых культур. Сейчас это не так опасно из-за развития устойчивых сортов, но вспышки могут возникать, когда возникают новые расы патогенов, против которых существующие виды устойчивости неэффективны.Стеблевая ржавчина остается серьезной угрозой для пшеницы и ячменя и, следовательно, для мировых запасов продовольствия. Антон деБари впервые продемонстрировал гетеродоксальный жизненный цикл ржавчинного гриба с помощью Puccinia graminis , возбудителя стеблевой ржавчины.

Симптомы и признаки

На пшенице и других злаках-хозяевах:
Растения обычно не проявляют явных симптомов заболевания до 7-15 дней после заражения, когда овальные пустулы (урединии) порошкообразных, кирпично-красных урединиоспор прорываются через эпидермис (рисунки 1, 2). .Микроскопически эти красные споры покрыты тонкими шипами (рис. 3, 4). Пустулы могут быть многочисленными и образовываться как на поверхности листьев, так и на стеблях травяных хозяев. Позже в сезон у инфицированных видов трав начинают появляться пустулы (телии) черных телиоспор (рис. 5). Микроскопически телиоспоры двухклеточные с толстыми стенками (рис. 6).

На барбарисе и других альтернативных хозяевах:
Пикния появляется на растениях барбариса (рис. 7) весной, обычно на верхней поверхности листьев.Они часто собираются небольшими скоплениями и источают пикниоспоры в липкой медвяной росе (рис. 8). Спустя 5-10 дней чашевидные структуры, заполненные оранжево-желтыми порошкообразными эциоспорами, прорываются через нижнюю поверхность листа (рис. 9). Чашечки надкрылий желтые, иногда удлиненные, до 5 мм от поверхности листа (рис. 10). Микроскопически эциоспоры имеют слегка бородавчатую поверхность (рис. 11).


Биология патогенов

Ржавчинные грибы — облигатные паразиты. В природе им для роста и размножения требуется живая ткань хозяина; они не могут существовать как сапрофиты.В отсутствие живой ткани хозяина они выживают как споры. У большинства ржавчинных грибов только телиоспоры приспособлены к выживанию отдельно от живого растения-хозяина более нескольких месяцев в полевых условиях.

Puccinia graminis разнородный. Это слово описывает ржавые грибы, которым для завершения жизненного цикла требуются два неродственных растения-хозяина, такие как пшеница и барбарис. Puccinia graminis является макроциклическим, продуцирующим все пять стадий спор: базидиоспоры, пикниоспоры (спермация), эциоспоры, урединиоспоры (уредоспоры) и телиоспоры.Антон де Бэри в 1865 году впервые осознал природу гетеродоксального жизненного цикла, но роль каждой стадии спор не была полностью понята до тех пор, пока в 1927 году канадский ученый Джон Крейги не изучил патоген.

Хотя стеблевая ржавчина вызывается одним видом гриба, Puccinia graminis , внутри этого вида существует значительная генетическая изменчивость. В 1884 году Эриксон обнаружил специфические для хозяина подвиды или «особые формы» гриба. Каждая специальная форма обозначается на латыни как forma specialis или «f.sp. «Все formae speciales имеют идентичный внешний вид, но различаются по диапазону хозяев. Возбудителем стеблевой ржавчины пшеницы ( Triticum aestivum ) является Puccinia graminis f. sp. tritici . Прочие formae speciales включают P. graminis f.sp. secalis , возбудитель стеблевой ржавчины ржи ( Secale cereale) , и P. graminis f.sp. avenae , возбудитель стеблевой ржавчины овса ( Avena sativa ).Оба Puccinia graminis f. sp. tritici и P. graminis f.sp. secalis вызывает стеблевую ржавчину у ячменя. Около 1916 г. Э. К. Стакман и другие определили, что в пределах P. graminis f.sp. tritici — это еще одно генетическое подразделение, называемое расами. Позже расы были обнаружены и в составе других formae speciales .

Цикл болезней и эпидемиология

Цикл заболевания стеблевой ржавчиной пшеницы начинается с заражения каждого нового урожая пшеницы спорами Puccinia graminis f.sp. tritici , которые являются первичным посевным материалом. Источник первых спор, поражающих новый урожай пшеницы, различается в зависимости от региона, в котором выращивается пшеница. В теплом климате пшеницу высаживают поздней осенью, а собирают ранним летом. Первыми спорами, поражающими молодые растения пшеницы осенью, являются урединиоспоры. Обычно они происходят от зараженных добровольных растений пшеницы. Семена, просыпанные в поле или на обочинах дорог во время сбора урожая, часто дают всходы и дают разрозненные растения-добровольцы.Эти растения могут инфицироваться спорами, образующимися на позднеспелых растениях пшеницы, еще находящихся в поле. Зараженные растения пшеницы-добровольца служат мостиком, переносящим P. graminis f. sp. tritici до следующего осеннего посева пшеницы.

В регионах с умеренным климатом пшеницу можно сажать осенью (озимая пшеница) или яровой (яровая пшеница) в зависимости от суровости зимы (Рисунок 12). Например, немногие сорта озимой пшеницы могут хорошо выжить в суровые зимы Миннесоты, Северной Дакоты и Манитобы, поэтому большая часть выращиваемой там пшеницы — это яровая пшеница.Первыми спорами ржавчины, заражающими пшеницу весной в регионах с умеренным климатом, могут быть эциоспоры барбариса, альтернативного хозяина, или урединиоспоры зараженной пшеницы в отдаленных регионах с более мягкими зимами. Таким образом, мы описываем два цикла заболевания стеблевой ржавчиной — с барбарисом или без него.


Рисунок 12-map6a

Рисунок 12-map6b

Рисунок 12-map7a

Рисунок 12-map7b

Цикл болезни, с барбарисом
Барбарис является наиболее опасным источником первичного инокулята стеблевой ржавчины в регионах с умеренным климатом.Если барбарис растет рядом с пшеничными полями, он будет постоянным источником эциоспор для самых ранних весенних инфекций пшеницы (рис. 13).


Рисунок 5

Рисунок 13

Puccinia graminis зимует в виде черных толстостенных диплоидных телиоспор, которые образуются на пшенице или других травах к концу вегетационного периода (Рисунок 5). Кариогамия (слияние двух гаплоидных ядер с образованием диплоидного ядра) и мейоз (редукционное деление с образованием четырех гаплоидных базидиоспор) имеют место в телиоспоре.Телиоспоры производятся в телии.

Весной каждая телиоспора прорастает с образованием тонкостенных бесцветных гаплоидных базидиоспор (рис. 14). Базидиоспоры заражают альтернативных хозяев, таких как барбарис обыкновенный.


Фиг.14

Рисунок 15

Базидиоспоры прорастают и продуцируют гаплоидный мицелий, который колонизирует ткань листа. Из этого мицелия внутри листа образуются пикнии, но с верхушками, проходящими через поверхность, обычно на верхнюю поверхность листьев барбариса.Пикния продуцирует восприимчивые гифы и пикниоспоры (рис. 15). Дальнейшего развития не произойдет до тех пор, пока рецептивные гифы в пикнии не будут оплодотворены пикниоспорами из пикниума другого типа спаривания. Некоторые авторы называют пикния и пикниоспоры спермагониями и сперматиями, но специалисты по ржавчине предпочитают первые.


Рисунок 16

Рисунок 8

Пикниоспоры (Рисунок 16) образуются в липкой пади, которая привлекательна для насекомых и помогает обеспечить успешное перекрестное оплодотворение (Рисунок 8).Насекомые переносят пикниоспоры от одного пикния к другому, когда они кормятся листьями, питаясь падевой росой. Брызги дождя также рассеивают пикниоспоры и способствуют перекрестному оплодотворению. Оплодотворение пикнии имеет решающее значение в жизненном цикле ржавого гриба, потому что оно дает начало дикариотическому мицелию. После того, как ядро ​​пикниоспоры присоединяется к ядру рецептивной гифы, парные гаплоидные ядра тандемно делятся в мицелии на протяжении оставшихся стадий жизненного цикла. Все инфекции стеблевой ржавчины пшеницы или других злаков связаны с дикариотическими спорами и дикариотическим мицелием.

В течение нескольких дней дикариотический мицелий прорастает через лист барбариса, пока новая структура, эций, не прорывается через нижнюю поверхность листа, высвобождая дикариотические эциоспоры (рис. 10). Хотя эциоспоры образуются на растениях барбариса, они могут инфицировать только пшеницу или другую траву-хозяина P. graminis . Эциоспоры (рис. 11) отличаются от урединиоспор, которые также инфицируют пшеницу, по своему внешнему виду — слегка бородавчатый, а не колючий — и по способу их образования — цепочками в эциуме, а не на отдельных стеблях урединиума.


Фиг.10

Рисунок 11

На пшенице прорастают эциоспоры, зародышевые трубочки проникают в растения, и гриб растет как дикариотический мицелий. В течение 1-2 недель мицелий при каждой инфекции производит урединий, заполненный кирпично-красными колючими дикариотическими урединиоспорами, которые прорываются сквозь эпидермис листа или стебля (рис. 1).


Рис. 1

В гетероциклических ржавчинах эта важная стадия спор называется «повторяющейся стадией», потому что урединиоспоры — единственные споры ржавчины, которые могут заразить растение-хозяин, на котором они образуются.При благоприятных условиях окружающей среды многократные повторяющиеся инфекции одного и того же растения пшеницы и соседних растений пшеницы могут привести к взрывным эпидемиям.


Рисунок 5

Рисунок 6

К концу вегетационного периода у телий образуются черные зимующие телиоспоры (Рисунок 5), и жизненный цикл завершается. Поскольку кариогамия и мейоз происходят в телиоспоре (рис. 6), эта стадия спор является важным источником генетической рекомбинации в дополнение к ее роли в качестве спор выживания.


Рисунок 17

Цикл заболевания, без барбариса
В Северной Америке эпидемии стеблевой ржавчины могут возникать в регионах с умеренным климатом, даже если барбарис отсутствует (Рисунок 17). В отсутствие барбариса первыми спорами P. graminis , достигающими пшеницы весной, являются переносимые ветром урединиоспоры, образующиеся на посевах озимой пшеницы на юге (рис. 18). Мягкий климат на побережье Мексиканского залива позволяет P.graminis для выживания и распространения на полях озимой пшеницы. Преобладающие южные ветры весной переносят урединиоспоры на север в центральные Великие равнины, где они заражают другие растения озимой пшеницы. Погода в центральной части Великих равнин обычно слишком холодная, чтобы зимой можно было инфицировать стеблевую ржавчину. Когда яровая пшеница начинает расти на севере Великих равнин, она может быть заражена урединиоспорами, переносимыми ветром с центральной или южной части Великих равнин. Цикл болезни стеблевой ржавчины на Севере заканчивается урожаем пшеницы.


Рис. 18

На юге цикл болезни стеблевой ржавчины начинается с урединиоспор, которые заражают сеянцы озимой пшеницы после осенней посадки. Большая часть, если не весь, первичный посевной материал является местным. Это происходит от добровольных растений пшеницы, которые проросли и заразились летом. Распространение урединиоспор с севера на юг вряд ли имеет значение. Яровую пшеницу на севере собирают в августе, задолго до появления нового урожая озимой пшеницы на юге, где посев может начаться только в октябре или позже.На юге растения барбариса не заражаются, поэтому там они не являются фактором эпидемии стеблевой ржавчины. Это связано с тем, что телиоспоры P. graminis не прорастут, если они не будут подвергаться длительному воздействию отрицательных температур.

Эпидемиология

Стеблевой ржавчине благоприятствуют жаркие дни (25-30 º C / 77-86 º F), мягкие ночи (15-20 º C / 59-68 º F) и влажные листья. от дождя или росы. Как эциоспоры, так и урединиоспоры нуждаются в свободной воде для прорастания, как и на других стадиях развития спор.Инфекции происходят через устьица.


Рис. 13

Источник инокулята можно предсказать по типу ржавчины. Если инокулят происходит от точечного источника барбариса, то в результате картина болезни обычно имеет веерообразную форму с альтернативным хозяином на вершине веера (рис. 13). Если болезнь имеет более однородный характер, источником инокулята обычно является обширная территория, такая как южные посевы пшеницы (в северном полушарии), из которых высвобождаются урединиоспоры.Разбросанные инфекции, главным образом, на верхних листьях пшеничного поля, указывают на то, что споры, переносимые воздухом, попали в поле из внешнего источника. Осадки важны для осаждения спор во время распространения спор на большие расстояния.

Если болезнь развивается в отдельных очагах на пшеничном поле, источником урединиоспор, вероятно, является перезимовавший мицелий и / или урединии. Ржавые растения в очагах из зимующих источников имеют тяжелую инфекцию в нижних листьях и меньшую инфекцию в более молодых листьях, сформированных выше на растениях пшеницы.

В отсутствие барбариса или других альтернативных хозяев урединиоспоры являются единственными функциональными спорами в цикле болезни P. graminis. В тропическом и субтропическом климате мицелий и урединиоспоры на пшенице-добровольцах и не злаковых травах вызывают эпидемии. Урединиоспоры обычно не могут выжить в суровых зимних условиях. В Северное полушарие посевной материал для яровой пшеницы поступает из южных районов. В Южном полушарии урединиоспоры прибывают из более мягких областей на севере.Иногда P. graminis может перезимовать у добровольцев пшеницы, растений-хозяев, не являющихся злаками, и озимой пшеницы, но обычно только там, где снежный покров изолирует как листья пшеницы, так и мицелий грибов. Это наиболее вероятно, если озимая пшеница засеяна непосредственно в стерню пшеницы от предыдущего урожая.

Урединиоспоры образуются примерно через 7-15 дней после заражения, поэтому в течение одного вегетационного периода может быть произведено несколько поколений инокулята. Один урединиум может производить не менее 100 000 урединиоспор.Взрывоопасные эпидемии могут возникать при благоприятных условиях окружающей среды, что приводит к потерям от 50 до 70% по региону.

Стеблевая ржавчина вызывает потерю урожая зерновых по нескольким причинам. Грибок поглощает питательные вещества из тканей растения, которые будут использоваться для развития зерна здорового растения. Когда пустулы прорываются сквозь ткань эпидермиса, растению становится трудно контролировать транспирацию, поэтому его метаболизм становится менее эффективным. Также может произойти высыхание или заражение другими грибами и бактериями.Воздействие на сосудистые ткани приводит к сморщиванию зерен. Стеблевая ржавчина также может ослабить стебли пшеницы, поэтому при сильном ветре и дожде растения поселяются или опадают (рис. 19). При сильном полегании нельзя убирать урожай механически.


Рисунок 19

Ведение болезней

Искоренение барбариса:
После определения жизненного цикла P. graminis стали очевидны потенциальные эффекты удаления альтернативного хозяина барбариса (рисунки 20, 21).Дорогостоящее и обширное обследование барбариса (рис. 22) и программа его искоренения были начаты в 1918 г. в США (рис. 23) и в ограниченных масштабах продолжаются и сегодня (рис. 24).

Первоначально предполагалось, что программа устранит стеблевую ржавчину как серьезное заболевание в Северной Америке, поскольку у базидиоспор не будет хозяев барбариса, которые можно было бы заразить, а урединиоспоры обычно не могли выжить в суровых зимних условиях. Важность континентального распространения эпидемий стеблевой ржавчины была понята только позже.Урединиоспоры зимуют на пшеничных полях на юге США и в северной Мексике, а затем переносятся по воздуху на север по тому, что сейчас называется «Путь Пуччинии» (рис. 25). Если погода благоприятствует развитию стеблевой ржавчины на юге, урединиоспоры прибудут вовремя и в достаточном количестве, чтобы вызвать эпидемии в северных районах выращивания пшеницы.

Несмотря на эту проблему, искоренение барбариса оказало значительное положительное влияние на борьбу с эпидемиями стеблевой ржавчины. Во-первых, он удалил значительный ранний источник инокулята.Одно растение барбариса может производить до 64 миллиардов эциоспор. Во-вторых, он уменьшил генетическую изменчивость грибковой популяции, исключив половой цикл, оставив только бесполые урединиоспоры для поддержания гриба. Мутация теперь является основным источником генетической изменчивости. Следовательно, больше не существует так много разных видов стеблевой ржавчины пшеницы, против которых селекционеры должны бороться. Наконец, эпидемии откладываются на несколько недель во многих основных районах выращивания пшеницы в США.S. и Canada, потому что эциоспоры были выпущены до первого прибытия урединиоспор с юга.

Культурные обычаи
Давно известно, что влага на листьях и избыток лиственного азота способствуют заражению ржавчиной грибами. Фермеры учитывают эти факторы в междурядьях, ориентации рядков и графиках внесения удобрений. Недавние изменения в производственных технологиях могут повлиять на стеблевую ржавчину. В некоторых районах посевы яровой пшеницы орошаются, что может увеличить выживаемость инфицированных растений-добровольцев.Кроме того, многие фермеры практикуют нулевую или минимальную обработку почвы. Это увеличивает вероятность того, что ржавые грибы могут успешно перезимовать в защитном слое стерни предыдущего урожая.

Использование ранее созревших сортов пшеницы на центральных Великих равнинах США помогло снизить угрозу эпидемий стеблевой ржавчины. Современные сорта пшеницы в этом регионе созревают примерно на 2 недели раньше, чем более старые сорта. Это ограничивает продолжительность развития эпидемий стеблевой ржавчины в центральной части Великих равнин, а также количество урединиоспор, которые могут способствовать развитию эпидемий дальше на север.

Генетическая устойчивость
Генетическая устойчивость является наиболее часто используемым и наиболее эффективным средством борьбы с стеблевой ржавчиной. Его успех в Северной Америке напрямую связан с уменьшением количества рас, присутствующих в грибной популяции после программы искоренения барбариса. Поскольку финансирование программы было сокращено в последние годы, ученые опасались, что оставшиеся кусты барбариса будут продолжать распространяться в районы выращивания пшеницы, чтобы служить как источником инокулята, так и средством, с помощью которого грибок может завершить свой половой цикл.Кроме того, ученые поняли, что даже в отсутствие барбариса нельзя ожидать, что используемые в настоящее время гены устойчивости будут оставаться эффективными бесконечно долго, поскольку новые расы гриба продолжают возникать в результате мутаций. По крайней мере, 50 различных генов расовой (вертикальной) устойчивости к стеблевой ржавчине были идентифицированы у пшеницы или переданы пшенице путем широкого скрещивания с дикими родственниками пшеницы. Не все эти гены устойчивости одинаково полезны. Многие были быстро исключены из программ селекции пшеницы, потому что вирулентные расы, которые смогли преодолеть свою устойчивость, уже преобладали в популяции грибов.Другие оказались широко эффективными при первом использовании, но новые вирулентные расы гриба появились в течение нескольких лет после широкого использования новой устойчивости.

По причинам, которые мы не до конца понимаем, несколько генов расовой (вертикальной) устойчивости к стеблевой ржавчине у пшеницы оставались высокоэффективными в течение многих лет. Наиболее успешным из них был Sr31 , ген, который встречается в сегменте хромосомы ржи, который был перенесен в пшеницу в результате сложного процесса межвидовой гибридизации.Пшеница с Sr31 быстро стала популярной во всем мире, потому что, помимо Sr31 , сегмент хромосомы ржи также несет гены, обеспечивающие повышенный урожай зерна, а также дополнительные гены устойчивости к другим болезням ржавчины. С 1980-х годов сорта пшеницы с содержанием Sr31 широко выращивались почти во всех основных производящих пшеницу регионах мира, кроме Австралии. Эффективность Sr31 была настолько велика, что к середине 1990-х годов стеблевая ржавчина пшеницы снизилась почти до незначительного уровня почти повсюду в мире.

Недавно было окончательно преодолено сопротивление Sr31 . Новая раса гриба стеблевой ржавчины пшеницы, обладающая высокой вирулентностью по отношению к сортам пшеницы с Sr31 , была обнаружена в Уганде в 1999 году. Новая раса, предварительно обозначенная как Ug99, быстро доминировала в популяции грибов в Уганде и распространилась в Кении и Эфиопии, где вызвала серьезные эпидемии. Через несколько лет Ug99 был обнаружен в Южной Африке и Йемене, откуда он распространился на север и восток до Ирана. Кажется неизбежным, что Ug99 вскоре вторгнется в один из самых богатых в мире производителей пшеницы в Пенджабе в Индии.Предыдущие примеры распространения ржавчины на большие расстояния включают распространение уникальной расы стеблевой ржавчины пшеницы из Южной Африки в Австралию, распространение кофейной ржавчины из Африки в Южную Америку и распространение южной кукурузной ржавчины из Центральной Америки в Африку. Что еще хуже, линия Ug99 гриба стеблевой ржавчины расширила свою вирулентность за счет мутаций, которые позволяют ему преодолеть устойчивость по крайней мере двух других генов вертикальной устойчивости, на которые селекционеры пшеницы полагались для защиты от стеблевой ржавчины в Северной Америке и во многих других странах. другие части мира.


Рисунок 26

В ответ на угрозу надвигающихся эпидемий стеблевой ржавчины пшеницы во всем мире в 2008 году были организованы международные усилия по снижению уязвимости посевов пшеницы в мире перед болезнями ржавчины. Организация, Borlaug Global Rust Initiative, координируется сотрудниками Корнельского университета и включает руководителей исследований из двух международных центров сельскохозяйственных исследований, CIMMYT и ICARDA, Продовольственной и сельскохозяйственной организации Объединенных Наций и Службы сельскохозяйственных исследований США.С. Департамент сельского хозяйства. Основные усилия сосредоточены на разработке и внедрении новых эффективных средств защиты от стеблевой ржавчины пшеницы во всем мире. Вертикальное сопротивление необходимо учитывать в краткосрочной перспективе, даже если долговечность сопротивления может быть сомнительной. Комбинация двух или более эффективных генов вертикальной устойчивости даст больше шансов на более длительную устойчивость. Однако в долгосрочной перспективе селекционеры пшеницы могут больше полагаться на минорные гены с дополнительными эффектами частичной устойчивости, выраженными в первую очередь у взрослых растений (т.е., горизонтальное сопротивление). Ряд высокоурожайных линий пшеницы с умеренным уровнем горизонтальной устойчивости уже разработан в Международном центре исследований пшеницы и кукурузы (CIMMYT). Эти передовые линии скрещиваются для получения улучшенных сортов пшеницы, сочетающих от четырех до пяти горизонтальных генов устойчивости для эффективного подавления эпидемий стеблевой ржавчины. Чтобы сохранить эти эффективные комбинации генов горизонтальной устойчивости даже после того, как эпидемия Ug99 утихнет, необходимо будет идентифицировать генетические маркеры для каждого из генов, чтобы селекционеры могли продолжать отбор на их наличие даже при отсутствии заболевания.

Химический контроль
В некоторых районах с высоким уровнем заболеваемости пшеницу применяют фунгициды для борьбы с болезнями ржавчины. Фунгициды, которые ингибируют синтез стеринов [т.е. ингибиторы биосинтеза стеролов (SBIs) или ингибиторы деметилирования (DMIs)], особенно эффективны, но стоимость их применения обычно непомерно высока для рутинного использования в большинстве областей выращивания пшеницы в США

Возможные подходы к управлению
Урединиоспоры поражают пшеницу только через устьица.Ученые изучили, как прорастающие урединиоспоры размещают устьица на поверхности листьев (рис. 27). Хотя задействовано несколько факторов, зародышевая трубка способна обнаруживать замыкающие клетки по их физическим размерам относительно эпидермальных клеток. После обнаружения стомы образуется аппрессорий и начинается инфицирование. В будущем, возможно, появится возможность вывести устойчивую пшеницу, которая устойчива к инфекции урединиоспор, поскольку ее эпидермальные структуры не распознаются грибком.


Рисунок 27

Историческое значение

Стеблевая ржавчина — одно из основных заболеваний пшеницы и ячменя и, следовательно, потенциальная угроза для мировых запасов продовольствия.Пшеница — самая крупная продовольственная культура в мире, а ячмень — шестая по величине. Вместе они составляют более 25% мировых запасов продовольствия. По оценкам, ежегодно из-за ржавчины зерновых (листовая ржавчина, стеблевая ржавчина и полосовая ржавчина) теряется более 5 миллиардов долларов. Зерновая ржавчина, вероятно, была проблемой с тех пор, как в Плодородном полумесяце были выращены первые зерновые культуры. Споры P. graminis были обнаружены на археологических раскопках в Израиле, датируемых 1300 годом до нашей эры. Пшеница, ячмень и барбарис произошли от плодородного полумесяца, поэтому эта сложная взаимосвязь в жизненном цикле стеблевой ржавчины имеет древнюю историю.

Ржавчина стеблей пшеницы была серьезной проблемой в Древней Греции и Риме. Ржавчина наблюдалась и распознавалась еще во времена Аристотеля (384-322 г. до н. Э.). Древние римляне приносили в жертву рыжих животных, таких как собаки, лисы и коровы, богу ржавчины Робиго или Робигусу каждую весну во время фестиваля, называемого Робигалия, в надежде, что урожай пшеницы будет спасен от разрушительного воздействия ржавчины (рис. 28). . Этот праздник был включен в ранний христианский календарь как День Св. Марка или Рогатион 25 апреля.Исторические погодные записи предполагают, что ряд дождливых лет, в течение которых ржавчина была бы более сильной, а урожай пшеницы сокращался, могли способствовать падению Римской империи.


Рисунок 28

Хотя паразитическая природа стеблевой ржавчины не была известна до 1700-х годов, фермеры в Европе гораздо раньше осознали, что барбарис каким-то образом связан с эпидемиями стеблевой ржавчины на пшенице. Законы, запрещающие посадку барбариса возле пшеничных полей, были впервые приняты в Руане, Франция, в 1660 году.

Итальянские ученые Фонтана и Тоццетти независимо друг от друга представили первые подробные описания стеблевого ржавчинного гриба у пшеницы в 1767 году. Персон назвал его Puccinia graminis в 1797 году. К 1854 году братья Туласне поняли, что некоторые самовозрастные (одиночные) ржавчинные грибы могут производят до пяти стадий спор. Они первыми соединили красную (урединиоспора) и черную (телиоспора) стадии как разные споры одного и того же организма, но оставшиеся стадии P.graminis осталось загадкой.

Антон деБари был озадачен отсутствием инфекции, когда базидиоспоры P. graminis были помещены на растения пшеницы. Используя мнение фермеров о том, что барбарис усиливает ржавчину пшеницы, он успешно привил барбарис базидиоспорами и наблюдал, как на альтернативном хозяине развиваются оставшиеся стадии спор. Как только была установлена ​​гетеродоксальная природа жизненного цикла, было обнаружено, что многие другие известные ржавые грибы разнородны, и их хозяева можно было объединить в пары.

Пшеница и барбарис были завезены в Северную Америку европейскими колонистами. Барбарис имеет ряд практических применений, включая желтый краситель для коры, варенья и вина из ягод, ручки для инструментов из дерева и быстрорастущие колючие изгороди, помогающие удерживать животных. Как и в Европе, фермеры начали осознавать связь между эпидемиями барбариса и стеблевой ржавчины у пшеницы. Законы о барбарисе были приняты в нескольких колониях Новой Англии в середине 1700-х годов. Тем не менее, барбарис продолжал распространяться по мере продвижения фермеров-пионеров на запад.Из приусадебных насаждений барбарис распространился на заборы и лесные участки. Кусты барбариса могут достигать 3 м в высоту и давать обильные ягоды, привлекательные для птиц и животных, которые питаются ими и распространяют свои семена.


Рисунок 22

Рисунок 29

После разрушительной эпидемии стеблевой ржавчины в Северной Америке в 1916 году в 1918 году была учреждена совместная государственная и федеральная программа искоренения барбариса (Рисунок 22).Частично эта программа была продиктована заботой о запасах продовольствия во время войны. Была начата «война против барбариса», в ходе которой заручились помощью широких масс населения посредством объявлений по радио и в газетах, рекламных проспектов и киосков на ярмарках, призывающих их помочь в уничтожении барбариса. Даже школьников поощряли помогать находить участки, где есть кусты барбариса (рис. 29). С 1975 по 1980 годы программа постепенно возвращалась в юрисдикцию различных штатов. Федеральный карантин все еще действует в отношении продажи устойчивого к стеблевой ржавчине барбариса в штатах, которые были частью программы искоренения барбариса.Была создана программа испытаний барбариса, чтобы гарантировать, что в зоне карантина будут выращиваться только виды и разновидности барбариса, такие как популярный декоративный японский барбарис, невосприимчивые к стеблевой ржавчине.

Избранные источники

Веб-сайт лаборатории болезней злаков USDA-ARS: Домашняя страница: http://www.ars.usda.gov/main/site_main.htm?modecode=36-40-05-00

Биология черной стеблевой ржавчины и угроза производителям пшеницы (из презентации на заседании Центрального совета растений 5-8 февраля 2001 г., Лексингтон, Кентукки).Веб-сайт лаборатории злокачественных болезней Миннесотского университета.

Введение в ржавчину зерновых: http://www.ars.usda.gov/Main/docs.htm?docid=9854

Информация о барбарисе: http://www.ars.usda.gov/Main/docs.htm?docid=9747

Бушнелл, W.R. и A.P. Roelfs, 1984. Зерновые ржавчины. Vol. 1. Происхождение, специфика, структура и физиология. Academic Press, Орландо.

Кэрфут, Г.Л. и Э.Р. Спротт, 1967. Голод на ветру. Rand McNally and Co., Чикаго.

Кук, Р.Дж. И Р.Дж. Весет, 1991. Управление здоровьем пшеницы. Пресса Американского Фитопатологического Общества, Сент-Пол, Миннесота.

Дубин, Х. Дж. И С. Раджарам, 1996. Селекция устойчивой к болезням пшеницы для тропических высокогорья и низменности. Ежегодный обзор фитопатологии 34: 503-526.

Large, E.C 1940. Advance of the Fungi. Dover Publications, Нью-Йорк.

Леонард, К.Дж. и Л.Дж. Сабо. 2005. Стеблевая ржавчина мелких зерен и трав, вызванная Puccinia graminis. Молекулярная патология растений 6: 99-111.

Littlefield, L.J.1981. Биология растительной растительности: введение. Издательство государственного университета Айовы, Эймс.

Макинтош, Р.А. и Г. Brown, 1997. Селекция с опережением на устойчивость пшеницы к болезням ржавчины. Ежегодный обзор фитопатологии 35: 311-326.

Петерсон, П.Д. (ред.) 2001. Стеблевая ржавчина пшеницы: от древнего врага до современного врага. APS Press. Сент-Пол, Миннесота.

Roelfs, A.P.1982. Влияние уничтожения барбариса на стеблевую ржавчину в Соединенных Штатах. Болезни растений 66: 177-181.

Роэлфс, А.П. 1989. Эпидемиология зерновой ржавчины в Северной Америке. Канадский журнал патологии растений 11: 86-90.

Roelfs, A.P., and W.R.Bushnell, 1985. Зерновые ржавчины. Vol. 2. Болезни, распространение, эпидемиология и контроль. Academic Press, Орландо.

Ролфс, А.П., Р.П. Сингх и Э.Э. Саари, 1992. Болезни ржавчины пшеницы: концепции и методы борьбы с болезнями. СИММИТ, Мексика, D.F.

Ug99 Ссылки

Borlaug Global Rust Initiative: http: // www.globalrust.org/

Веб-сайт ФАО по распространению расы Ug99: http://www.fao.org/agriculture/crops/rust/stem/rust-report/stem-ug99racettksk/en/

Сингх Р. П., Д. П. Hodson, J. Huerta-Espino, Y. Jin, P. Njau, R. Wanyera, S.A. Herrera-Foessel и R.W. Ward. 2008. Сможет ли стеблевая ржавчина уничтожить урожай пшеницы в мире? Успехи в агрономии 98: 272-309. (PDF-файл этой ссылки можно найти по адресу http://ddr.nal.usda.gov/bitstream/10113/36520/1/IND442.pdf

Стоун, М. 2010.Новые вирулентные штаммы ржавчины представляют опасность для мировой пшеницы. Microbe 5: 423-428. Http://www.microbemagazine.org/index.php/09-2010-home/2849-virulent-new-strains-of-rust-fungus-endanger-world-wheat

Тепловой стресс Ответы у большого набора сортов озимой пшеницы (Triticum aestivum L.) зависят от времени и продолжительности стресса

Abstract

Неблагоприятное воздействие тепла на урожай растений сильно зависит от его продолжительности и фенологической стадии урожая, когда наступает тепло.Чтобы прояснить влияние этих двух аспектов теплового стресса, были проведены систематические исследования в контролируемых условиях на 101 сорте пшеницы различного географического происхождения. Применяли разную продолжительность теплового стресса (5, 10 и 15 дней), начиная с трех стадий развития (ZD49: стадия зарождения, ZD59: колошение, ZD72: 6 день после колошения). Были измерены различные морфологические, связанные с урожайностью признаки и физиологические параметры, чтобы определить характер стрессовой реакции генотипов пшеницы при комбинациях продолжительности и времени теплового стресса.Фенологические сроки существенно повлияли на массу тысячи зерен и количество репродуктивных побегов. Продолжительность теплового стресса была наиболее значимым компонентом в определении как количества семян, так и веса семян, а также урожайности зерна, следовательно, объясняя 51,6% его фенотипической дисперсии. Независимо от фазы развития, характеристики, связанные с урожайностью, постепенно ухудшались, и даже пятидневного теплового стресса было достаточно, чтобы вызвать значительное снижение. ZD59 был значительно более чувствителен к нагреванию, чем ZD49 или ZD72.Фотосинтетическая активность флагового листа во многом определялась продолжительностью теплового стресса. Не было замечено значительных ассоциаций между физиологическими параметрами и реакцией на тепловой стресс, измеренной по урожайности зерна. Между генотипами пшеницы наблюдались значительные различия в ответах на тепловой стресс, которые сильно варьировались в зависимости от фазы развития. На основании урожайности зерна на разных этапах развития и обработки теплового стресса можно было идентифицировать восемь основных групп ответа генотипов пшеницы, и среди них три кластера были наиболее термостойкими.Эти сорта в настоящее время включены в схемы скрещивания, частично для определения генетических детерминант реакции на тепловой стресс, а частично для создания новых сортов пшеницы с лучшей термостойкостью.

Образец цитирования: Balla K, Karsai I., Bónis P, Kiss T, Berki Z, Horváth Á, et al. (2019) Реакция на тепловой стресс у большого набора сортов озимой пшеницы ( Triticum aestivum L.) зависит от времени и продолжительности стресса. PLoS ONE 14 (9): e0222639.https://doi.org/10.1371/journal.pone.0222639

Редактор: Аймин Чжан, Институт генетики и биологии развития Китайской академии наук, КИТАЙ

Поступила: 31 мая 2019 г .; Принята к печати: 4 сентября 2019 г .; Опубликовано: 20 сентября 2019 г.

Авторские права: © 2019 Balla et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все соответствующие данные находятся в рукописи и ее файлах с вспомогательной информацией.

Финансирование: Данная исследовательская программа финансировалась за счет гранта Национального фонда научных исследований (NKFIH) K-119801 и проекта GINOP-2.3.2-15-2016-00029 (Операционная программа экономического развития). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Введение

Глобальное изменение климата все больше влияет на растениеводство. Экстремальные погодные условия, особенно аномалии температуры и осадков, существенно влияют на успех выращивания. Необычно высокая температура — одна из наиболее частых форм абиотического стресса, представляющая большую опасность для растениеводства. Ожидается, что экстремальные температурные явления станут более частыми во многих основных регионах-производителях пшеницы. Эти погодные условия могут характеризоваться кратковременной продолжительностью и повышением температуры более чем на 5 ° C по сравнению с нормальной температурой [1–3].Наблюдаются тенденции к увеличению количества жарких (Tmax ≥30 ° C) и жарких дней (Tmax ≥ 35 ° C) [4].

Способность пшеницы адаптироваться к широкому спектру экологических условий сделала ее одной из самых важных культур во всем мире, но тепловой стресс оказывает серьезное негативное влияние на урожайность, особенно когда он связан с другими стрессовыми факторами. Комбинированный стресс часто поражает растения пшеницы во время колошения или в период налива зерна, поэтому необходимо активизировать исследования воздействия теплового стресса [5–7].На степень повреждения большое влияние оказывает фенофаза, в которой растения подвергаются стрессу [8]. Стадия цветения обычно считается наиболее чувствительной к тепловому стрессу [9], поскольку отрицательно сказывается как на мейозе, так и на росте пыльцы. Сложные взаимодействия между сроками фенологических стадий и чувствительностью различных фаз роста к окружающей среде влияют на конечный урожай [10].

Пороговая температура вегетативного развития у пшеницы составляет 20–30 ° C [11], а для репродуктивного роста — 15 ° C [12].Согласно Tewolde et al. [13], цветение и наполнение зерна имеют пороговую температуру 12–22 ° C, что приводит к значительному снижению урожайности зерна при более высоких температурах. Неблагоприятные эффекты тепла зависят от величины, времени и продолжительности стресса. Портер и Гавит сообщили [8], что в период цветения максимальная температура, которую может выдержать пшеница без уменьшения количества зерен, составляет 31 ° C. Этот период был определен как продолжающийся примерно от 20 дней до цветения до 10 дней после цветения [14,15].Более высокие температуры ускоряют наступление цветения, в результате чего на один колос приходится меньше колосков [16]. Кроме того, высокая температура около цветения приводит к снижению фертильности пыльцы или стерильности зерна из-за отрицательного воздействия тепла (> 30 ° C) на жизнеспособность пыльцы, что приводит к плохому оплодотворению, аномальному развитию завязей, замедлению роста пыльцы и, таким образом, уменьшению посевного материала. настройка [17–20].

Пшеница часто подвергается кратковременному воздействию высоких температур (33–40 ° C) во время цветения и налива зерна [21–23].Было обнаружено, что трехдневный период очень высокой температуры (макс. 40 ° C) после цветения снижает количество и вес зерен и приводит к большему количеству деформированных зерен [24]. Даже один день теплового стресса может нанести серьезный ущерб урожаю зерна и его составляющим. Рахман и др. [25] сообщили, что высокая температура привела к значительному ускорению развития, цветения и созревания. Период налива зерна может быть короче на 3–12 дней в результате термической обработки [26,27]. Другие авторы сообщают, что высокие температуры сокращают период налива зерна на 45–60% [28,29].Однако наблюдалась значительная генетическая изменчивость в степени реального воздействия на период налива зерна [30].

Высокая температура оказывает особенно сложное влияние на многочисленные физиологические процессы, которые, в свою очередь, влияют на фотосинтетическую активность растений пшеницы [31,32]. Фотосинтез — один из основных метаболических процессов, влияющих на урожайность зерновых [33], поэтому чистая фотосинтетическая активность и содержание хлорофилла являются важными индикаторами адаптации пшеницы к жаре и другим факторам абиотического стресса [34].И фотосинтез, и выход сухого вещества зависят от развития оптимальной площади листа. Старение растений начинается с распада молекул хлорофилла, что приводит к замедлению фотосинтетической активности [35,36]. Было обнаружено, что тепловой стресс во время цветения и наполнения зерна ускоряет деградацию содержания хлорофилла в листьях, что приводит к снижению как фотосинтетической активности листа, так и конечной биомассы [31,37,38]. Высокие температуры также привели к увеличению скорости старения листьев [23,39,40].Тепло отрицательно сказывается как на урожайности зерна, так и на его качестве. Бхуллар и Дженнер [41] сообщили, что на перемещение фотосинтетических ассимилятов во время заполнения зерна отрицательно влияет тепловой стресс, что приводит к снижению качества зерна. Тепловой стресс вызывает обезвоживание тканей и ухудшение усвоения СО2 на репродуктивной стадии [42]. На поглощение CO2 из воздуха влияет закрытие и открытие устьиц, поэтому зависимость этого процесса от температуры имеет большое значение.Повышенная транспирация, вызванная высокой температурой, вызывает закрытие устьиц, что косвенно влияет на фиксацию СО2 в процессе фотосинтеза. Ингибирование фотосистемы II (ФСII), наиболее термолабильного компонента фотосинтетической цепи переноса электронов, может быть причиной замедления фотосинтеза, нарушения активности транспорта электронов и инактивации выделяющих кислород ферментов ФСII, которые приводят к замедлению фотосинтеза. для снижения скорости регенерации рибулозо-1,5-бисфосфата (RuBP) [30,43–46].

Для дальнейшего повышения устойчивости к абиотическому стрессу очень важно оценить разнообразие типов стрессовых реакций культурных сортов пшеницы и выявить генотипы с более высоким уровнем стрессоустойчивости. Также существует острая потребность в идентификации и характеристике различных механизмов, участвующих в толерантности, и в идентификации генетических компонентов, лежащих в основе этих механизмов. Однако в большинстве исследований используется только ограниченное количество генотипов пшеницы [19,47,48], и особенно мало исследований, в которых систематически сравнивались эффекты теплового стресса различной продолжительности при применении на разных этапах развития.

Поскольку оценка термостойкости является важным компонентом селекционных программ, направленных на улучшение экологической адаптации зерновых, исследования устойчивости к тепловому стрессу были начаты в Сельскохозяйственном институте (MTA ATK MGI) в Мартонвашаре [49–51]. Чтобы идентифицировать различные типы стрессовых реакций у разных сортов пшеницы, эксперименты проводились в контролируемых условиях роста, что позволяло использовать одну и ту же экспериментальную установку в разных экспериментах и ​​применять тепловой стресс на одной и той же фенологической стадии для каждого сорта пшеницы. делая сравнения более точными.

На основе предыдущих исследований было запланировано систематическое исследование, включающее большой набор сортов пшеницы с широким генетическим фоном (i) для оценки влияния различной продолжительности теплового стресса в разных фазах развития растений на физиологические и связанные с урожайностью признаки и ( ii) применить подробную фенотипическую характеристику при различных воздействиях теплового стресса, что позволит (iii) проанализировать зависимые от теплового стресса ассоциации между различными компонентами в формировании урожайности зерна и (iv) определить, можно ли найти конкретную кластеризацию генотипов пшеницы на основе их профилей реакции на тепловой стресс, измеренных по изменениям урожайности зерна / растения.Эта информация позволит инициировать скрещивания между различными членами идентифицированных кластеров реакции на тепловой стресс как для целей разведения, так и для оценки генетических компонентов устойчивости к тепловому стрессу.

Материалы и методы

Управление земледелием

Всего 101 сорт озимой пшеницы с различным географическим происхождением (таблица S1) был включен в серию экспериментов, проведенных в контролируемых условиях в теплице и фитотроне, для изучения их реакции на различную продолжительность теплового стресса, применяемого на разных стадиях развития.Реакции сортов пшеницы на тепловой стресс определялись в трех независимых экспериментах, в которых применялись одни и те же стандартные протоколы выращивания растений. Один эксперимент охватывал скрининг реакции на тепловой стресс в одной фенологической фазе, и три исследуемые фазы развития включали стадию выкармливания (ZD49), стадию колошения (ZD59), когда завершилось появление соцветий, и 6 -й день после заголовок (ZD72). Обработка тепловым стрессом длилась 5 (H5), 10 (h20) или 15 (h25) дней на всех трех стадиях развития.Фенофазы растений контролировали каждый день и определяли по двузначной системе шкалы Задокса [52]. В результате мониторинга развития каждое растение пшеницы подвергалось воздействию теплового стресса на той же конкретной стадии развития, которая исследовалась в рамках данного эксперимента.

Во всех трех экспериментах проросшие проростки яровировали в торфяных блоках в течение 60 дней при 4 ° C с низкой интенсивностью света и коротким световым днем, и проростки переносили в отдельные горшки, вмещающие приблизительно 1.5 кг смеси садовой земли, компоста и песка 3: 2: 1. Растения выращивали в тепличных условиях с ежедневным поливом и двухнедельной подачей питательных веществ (раствор Volldünger, Линц, Австрия, в водопроводной воде).

Условия окружающей среды

После обработки яровизацией растения выращивали в теплице в относительно стандартных условиях, в которых температура окружающей среды находилась в диапазоне от 25 ° C (день) до 19 ° C (ночь), а условия естественного освещения дополнялись искусственным освещением 170 мкмоль. м –2 с –1 интенсивность, создаваемая металлогалогенными лампами для достижения 16-часового режима фотопериода за 24-часовой цикл.В каждом отдельном эксперименте на трех фазах развития 18 растений каждого генотипа выращивали в отдельных горшках в теплице и регулярно чередовали в процессе наблюдения за паттернами их развития. Двенадцать из 18 исходных растений с наиболее сходными аспектами развития и фенологии были отобраны и включены в стрессовый эксперимент, в результате чего на обработку было получено 3 растения в качестве биологических повторений (C, H5, h20 и h25). Контрольные растения трех отдельных экспериментов представляли собой частичные технические повторения.

Контрольные растения каждого сорта выращивали в теплице на протяжении всего жизненного цикла, и растения с запланированным стрессом каждого сорта на данной фенофазе переносили в камеру теплового стресса (Conviron PGV-36) в фитотроне Мартонвашара на определенный период времени. время (H5, h20 или h25). В конце периода обработки растения переносили обратно в теплицу и выращивали вместе с контрольными растениями до созревания. В камере теплового стресса растения содержались в режиме 16-часового фотопериода и интенсивности света 350 мкмоль м –2 с –1 , создаваемого металлогалогенными лампами.Температурный профиль применялся следующим образом: ночная температура 20 ° C, дневная температура, которая постепенно повышалась до 36 ° C и поддерживалась в течение 8 часов, с последующим постепенным понижением температуры до 20 ° C. Относительная влажность (RH%) была установлена ​​на уровне 64–68% днем ​​и 76% ночью в стрессовой камере. Для расчета дефицита давления пара (VPD) мы применили формулу VPD = (100-RH) / 100 * SVP, где RH — относительная влажность, а SVP — давление насыщенного пара (CronkLab: http: // cronklab.wikidot.com/calculation-of-vapour-pressure-deficit). На основе этого расчета VPD в камере теплового стресса составлял 1,9–2,13 кПа днем ​​и 0,56–0,63 кПа ночью. Эти значения соответствуют горячей и влажной среде при тепловом стрессе [53–55]. В теплице VPD составлял приблизительно 0,703–1,01 кПа в течение дня.

Всего экспериментальная установка состояла из 101 генотипа × 3 растения × 3 продолжительности теплового стресса × 3 фазы развития.

Морфологические измерения

Различные морфологические параметры и параметры урожайности были измерены после того, как растения достигли зрелости урожая.Морфологические параметры включали измерения высоты растения (PH), длины последнего междоузлия (LIN), длины главного колоса (EaL) и количества колосков в главном колосе (SPIK). Плотность спайков (DENS) была рассчитана на основе двух последних данных. Параметры, связанные с урожайностью, были следующими: количество репродуктивных побегов (RT), биомасса соломы на растение (BIOM), общая надземная биомасса (солома + все початки, FBIOM), масса основного початка (MEaW), масса основного посевного материала ( MSW), количество основных семян (MSN), общий вес боковых початков (SEAW), общий вес боковых семян (SSW), общее количество боковых семян (SSN) и урожай зерна с растения (GY).Индекс урожая (HI), количество зерен в колосе (SPS), масса тысячи зерен в главном колосе (MTKW), средний вес тысячи зерен (ATKW), среднее количество семян (AS) и средний вес семян (ASW) были рассчитывается по этим данным.

Физиологические измерения

Среди физиологических параметров, содержание хлорофилла (CLR) было измерено однократно после обработки тепловым стрессом с использованием прибора SPAD-502 (Minolta, Япония), который регистрирует коэффициент пропускания листьев в красном и ближнем инфракрасном спектрах и впоследствии рассчитывает Индекс SPAD из этих двух значений.В повторностях три растения пшеницы (на обработку) измеряли в середине флагового листа на содержание хлорофилла.

Активность фотосинтетических свойств, а именно чистую скорость ассимиляции (PN), испарение (EVP), устьичную проводимость (GS) и межклеточную концентрацию CO 2 (ICO) растений, измеряли с помощью CIRAS 2 — Portable Photosynthesis. Система (версия учебного пособия 2.03; Эймсбери, Массачусетс 01913, США). Инфракрасная система газоанализа была оборудована листовой кюветой, которая экспонировала 1.7 см 2 листовой поверхности. Листья флага во время измерений хранились в камере для листьев. Внешний воздух был очищен от CO 2 и смешан с запасом чистого CO 2 для создания контрольной концентрации 390 мкмоль м –2 с –1 . Концентрация CO 2 поддерживалась на постоянном уровне с помощью инжектора CO 2 с источником газового картриджа CO 2 высокого давления. Квантовый поток был установлен равным 300 мкмоль м –2 с –1 , а скорость потока — 200 мкмоль м –2 с –1 .Температура внутри камеры для листьев поддерживалась на уровне 22 ° C в контрольных условиях и 35 ° C в условиях теплового стресса. Параметры фотосинтеза определялись одновременно с содержанием хлорофилла. В общей сложности 26 признаков, включая 5 морфологических, 16 связанных с урожайностью и 5 физиологических признаков, были исследованы во всех вариантах обработки.

Статистический анализ

Пакеты программ Statistica 6 (StatSoft Inc., Tulsa, OK, USA) и GenStat® (VSN International Ltd., 18-е изд.) Использовались в общем статистическом анализе.Информация о распределении исходных данных при различных обработках представлена ​​прямоугольными диаграммами на S1 рис.

.

Смешанная линейная модель (REML) использовалась для определения эффектов времени и продолжительности теплового стресса и генотипов при объяснении фенотипической дисперсии измеренных признаков. При оценке компонентов дисперсии (σ 2 ) все эффекты (генотип (G), фаза развития (D) и продолжительность течки (H)) рассматривались как случайные, чтобы можно было оценить взаимодействие факторов.Анализ главных компонентов (PCA), линейная и множественная регрессия и многомерный анализ были выполнены на подвыборке из 16 признаков, охватывающих все три группы признаков, для оценки ассоциаций более высокого порядка между обработками, признаками и генотипами.

Для определения чувствительности к тепловому стрессу различных сортов был проведен кластерный анализ (CA) матрицы данных 101 сорта × их урожайность зерна (г / растение) в каждой из 12 сред, применяя правило объединения невзвешенных пар- среднее значение группы в модуле кластеризации дерева объединения в Statistica 6.Чтобы визуализировать результат CA, каждая точка данных в матрице была выражена как величина отклонения от основного среднего значения урожайности зерна в каждой среде. Для дальнейшего анализа типа и величины взаимосвязи между сортами, PCA также был проведен на той же матрице данных (S2, рис.).

Результаты

Влияние времени и продолжительности теплового стресса на свойства, связанные с урожайностью

В экспериментальной установке, состоящей из 101 генотипа пшеницы × 3 фазы развития × 3 продолжительности теплового стресса, на все признаки значительно влияли три фактора, но в разной степени (Таблица 1).

Таблица 1. Компоненты дисперсии (%) морфологических, связанных с урожайностью и физиологических признаков в контексте 101 сорта пшеницы × три момента времени (фаза развития) × три продолжительности теплового стресса с использованием общей линейной модели.

https://doi.org/10.1371/journal.pone.0222639.t001

В целом морфологические признаки в основном определялись генотипом, который объяснял от 53,1% (LIN) до 83,9% (PH) фенотипической дисперсии. В случае признаков, связанных с урожайностью, влияние генотипа было значительным, но его роль была меньше, объясняя только между 14.6% (HI) и 40,8% (BIOM) фенотипической дисперсии. Параллельно оба аспекта теплового стресса, то есть фаза развития, в которой он применялась, и особенно продолжительность лечения стали более решающими факторами. Фаза развития существенно повлияла на массу тысячи зерен и количество репродуктивных побегов, но не оказала существенного влияния на урожайность зерна. Напротив, продолжительность теплового стресса была наиболее значимым компонентом при определении как количества семян, так и веса семян и была более выраженной в случае боковых колосьев.Благодаря этим двум группам компонентов продолжительность теплового стресса стала наиболее значимым компонентом урожайности зерна, объясняя 51,6% фенотипической дисперсии (S1, рис.). В среднем по 101 сорту общая реакция на тепловой стресс заключалась в значительном снижении урожайности зерен растений, соотношение которого ухудшалось по мере увеличения продолжительности теплового стресса, независимо от фазы развития, на которой применялось тепло (рис. доверительные интервалы, см. таблицу S2). Однако наблюдались заметные различия между фазами развития с точки зрения степени снижения урожайности зерна и изменений различных связанных с урожайностью признаков.Снижение урожайности зерна было наибольшим при ZD59, когда урожай зерна составлял только 32,2% от контрольного значения после 15-дневного теплового стресса, тогда как у ZD49 и ZD72 урожайность зерна была аналогичной, с урожайностью 51,6 и 51,8% соответственно по сравнению с контроль. Изменения отдельных признаков, связанных с урожайностью, были фенофазно-специфическими. Снижение AS было одинаково сильным как для ZD49, так и для ZD59, но это снижение было частично компенсировано RT и ATK на ZD49, которые оставались стабильными при всех обработках, а при ZD59 снижение AS сопровождалось сильным снижением RT и BIOM. , что приводит к значительному снижению ATK по мере удлинения периода течки.В ZD72 тепловой стресс не оказывал значительного влияния на RT, но снижал AS, хотя и в меньшей степени, чем в двух других фенофазах. Однако это наблюдение сопровождалось наибольшим снижением ATKW. Тепловой стресс оказал наименьшее общее влияние на морфологические признаки, что представлено значениями PH и SPIK на рис. 1. PH немного снизился, но это было характерно только для самой ранней фазы развития. SPIK был постоянным для всех видов лечения на всех трех стадиях развития.

Рис. 1. Изменения различных морфологических и связанных с урожайностью признаков в разных фенофазах.

Значения выражены в% от контроля, вызванного тепловым стрессом разной продолжительности, применяемым в фенофазах A: ZD49, B: ZD59, C: ZD72. PH — Высота растения, SPIK — Число колосков на главный колос, BIOM — Биомасса соломы, RT — Репродуктивные побеги, HI — Индекс урожайности, AS — Среднее количество семян, — ATKW — ATKW Средняя масса тысячи зерен, GY — Урожайность зерна; H5 — h20 — h25 —Тепловой стресс продолжительностью 5, 10 и 15 дней; ZD49 — стадия зарождения, ZD59 — начальная точка, ZD72— Раннее развитие молока.Доверительные интервалы для признаков перечислены в таблице S2.

https://doi.org/10.1371/journal.pone.0222639.g001

Влияние времени и продолжительности теплового стресса на параметры фотосинтеза

В случае физиологических признаков и генотипические различия, и фазы развития были менее решающими, а продолжительность теплового стресса объясняла наибольшую часть дисперсии, особенно для GS (66,0%) и PN (89,4%). Содержание хлорофилла (CLR) было единственным исключением, которое объяснялось генотипом и фазой развития 36.5% и 12,5% фенотипической дисперсии соответственно. Из взаимодействий и генотип × фаза развития растения, и генотип × продолжительность течки были значимыми компонентами дисперсии для большинства признаков, но в целом они объясняли меньшую часть дисперсии, чем основные факторы.

В случае физиологических признаков общие реакции были сходными во всех трех фазах развития, причем различия проявлялись в основном в течение продолжительности воздействия теплового стресса (рис. 2).Устьичная проводимость (GS) и чистая ассимиляция (PN) показали сильное снижение даже после 5-дневной термообработки, но значения снизились лишь незначительно в ответ на более длительные периоды течки. Эти характеристики несколько усилились на более поздних этапах развития. Интересно, что испарение (EVP) в значительной степени увеличивалось после 5-дневного теплового стресса, но впоследствии постепенно уменьшалось по мере продолжения тепловой обработки, снижаясь до близкого к контрольному значению после 15-дневного периода тепла. Для EVP ответы были наиболее сильными при ZD49, когда он увеличился почти до 200% от контроля после 5-дневного периода течки, тогда как величина изменений уменьшилась на более поздних фазах развития.Значения межклеточного CO 2 (ICO) и хлорофилла (CLR) существенно не изменились из-за обработки тепловым стрессом на любой из фенофаз.

Рис. 2. Изменение параметров фотосинтеза, вызванное тепловым стрессом разной продолжительности, применяемым в разных фенофазах.

A: ZD49, B: ZD59, C: ZD72 EVP — Испарение, GS — Стоматальная проводимость, PN — Чистая ассимиляция, ICO — Межклеточная концентрация CO 2 , содержание CLR , H5 h20 — h25— Тепловой стресс продолжительностью 5, 10 и 15 дней; ZD49 — стадия загрузки, ZD59 — заголовок, ZD72 — раннее развитие молока.

https://doi.org/10.1371/journal.pone.0222639.g002

Зависимые от теплового стресса ассоциации между различными компонентами в формировании урожая зерна

Анализ главных компонентов был проведен на матрицах данных 101 сорта × 16 признаков, выбранных для представления трех групп признаков (морфологических, связанных с урожайностью, физиологических), и связь между признаками сравнивалась в контроле и 15-дневной охоте. лечение стресса на трех стадиях развития (рис. 3).В контрольной обработке параметры, относящиеся к количеству семян (AS, MSN, SPS) и массе тысячи зерен (ATKW, MTKW), сформировали две слегка противоположные группы. Те, которые связаны с количеством семян (AS, MSN), были более тесно связаны с количеством семян на один колоск (SPS), а масса тысячи зерен более тесно связана с числом репродуктивных побегов и высотой растения. Сгруппированные вместе физиологические характеристики, а также индекс урожая и количество семян на колосок были помещены напротив веса тысячи зерен.Урожайность зерна, тесно связанная с биомассой и количеством колосков в главном колосе, была помещена промежуточно между количеством семян и массой тысяч зерен. В контрольной обработке биомасса, количество семян и урожай зерна были наиболее дифференцированными признаками.

Рис. 3. Сравнение различных паттернов ассоциации признаков на основе анализа главных компонентов.

В контроле (А) и после 15-дневной обработки тепловым стрессом в фенофазах ZD49 (B), ZD59 (C) и ZD72 (D). PH — Высота растения, SPIK — Число колосков на главном колосе, MSN — Число основных семян, SPS — Число зерен на колосок, MTKW — Масса основной тысячи зерен, RT — Репродуктивные побеги , BIOM — биомасса соломы, GY — урожай зерна, HI — индекс урожая, AS — среднее количество семян, ATKW — средний вес тысячи зерен, EVP — испарение, GS — Устьичная проводимость, PN — чистая ассимиляция, ICO — внутриклеточная концентрация CO 2 , CLR — содержание хлорофилла.

https://doi.org/10.1371/journal.pone.0222639.g003

Фенофазно-специфические изменения наблюдались в этих ассоциациях после 15-дневного теплового стресса, что привело к двум отдельным и тесным группам признаков с самые сильные дифференцирующие способности у ZD49. Одна группа включала урожай зерна вместе с признаками, связанными с количеством семян и индексом урожая, тогда как другая группа состояла из физиологических признаков, на которые наиболее сильно влияли испарение и устьичная проводимость.Вес тысячи ядер, биомасса и репродуктивные побеги были слабо связаны с этими двумя группами и не оказали существенного влияния на их формирование. На более поздних этапах развития тепловой стресс не приводил к образованию плотных группировок этого типа, и ассоциации постепенно становились более похожими на контроль по мере приближения фазы развития к периоду созревания, особенно в случае ассоциаций, связанных с урожайностью зерна. ZD59 по-прежнему демонстрировал тесную положительную связь между урожайностью зерна и количеством семян.Хотя вклад количества семян в урожай зерна уменьшился, этому наблюдению противодействовали больший вклад биомассы, репродуктивного числа побегов и количества колосков и, в меньшей степени, веса тысячи зерен и высоты растения. В ZD72 урожай зерна был сгруппирован по тем же связанным с урожаем признакам, что и в контроле, хотя и более жестко. После 15-дневного теплового стресса значимость физиологических показателей в разделении ПКС возрастала независимо от фазы развития.Однако физиологические параметры в большинстве случаев не зависели от урожайности зерна и его компонентов в матрицах отклика 101 сорта пшеницы, за некоторыми исключениями. При контрольной обработке испарение показало положительную связь с индексом урожая и отрицательную связь с массой тысячи зерен. В ZD59 внутриклеточная концентрация CO 2 была сгруппирована вместе с массой тысячи зерен и в определенной степени была отрицательно связана с урожаем зерна. Этот тип специфической ассоциации был наиболее выражен в ZD72, где испарение, чистая ассимиляция и устьичная проводимость оказывали отрицательное влияние на массу тысячи зерен.

Профили реакции на тепловой стресс сортов пшеницы

Поскольку урожай зерна растений является самым сильным и окончательным показателем стрессоустойчивости, были проведены различные многовариантные анализы матрицы данных урожайности растений для всех 12 обработок × 101 генотип для оценки реакций теплового стресса генотипов пшеницы и установления диапазон реакций теплового стресса, обнаруживаемых в этой коллекции пшеницы (рис. 4).

Рис. 4. Тепловая карта средней урожайности зерна / растение (г) по генотипам пшеницы и обработкам.

Строки представляют 101 генотип пшеницы, а столбцы — различные обработки, выраженные как разница между индивидуальным генотипом и основным средним GY для каждой обработки (в столбце). Основное среднее значение GY для каждого лечения (g) представлено в нижней части каждого столбца. C —Контроль, H5 — h20 — h25 —Тепловой стресс продолжительностью 5, 10 и 15 дней; (Задокс) 49– Стадия загрузки, 59 — Заголовок, 72 — Раннее развитие молока; GY — урожай зерна; LSD —Наименее достоверное различие при P = 0.05.

https://doi.org/10.1371/journal.pone.0222639.g004

На основе кластерного анализа восемь групп сортов пшеницы могут быть идентифицированы на 32% наибольшего расстояния на дендрограмме. Эти кластеры также были четко разделены в большинстве случаев, когда анализ главных компонентов выполнялся на одной и той же матрице данных (S2 рис; члены каждого кластера перечислены в таблице S1). Единственным исключением был кластер 7, который был самой большой группой с 37 генотипами. Эти элементы показали больший разброс по Фактору 2, который коррелировал в первую очередь с урожайностью зерна при более длительных периодах теплового стресса в ZD59.В целом, не было выявлено сильной связи между реакцией на тепловой стресс и географическим происхождением генотипов пшеницы (таблица S1), за исключением кластеров 1, 3 и 4, которые имели наименьшее количество членов (5, 5 и 9), но представляли крайности формирования урожайности. Большинство Clu1 и Clu3 были западноевропейского происхождения, тогда как большинство культурных сортов Clu4 происходили из Китая и Южной Европы. Судя по тепловой карте урожайности зерна, кластеры 1, 2 и 3 были среди лучших по всем контрольным обработкам и обработкам теплового стресса.Противоположное было верно для кластера 4, члены которого дали самый низкий урожай зерна независимо от обработки, за ним следует кластер 5, тогда как кластеры 6, 7 и 8 были промежуточными в своих реакциях. Когда урожай зерна контрольных растений сравнивали в трех экспериментах в трех фазах развития, урожайность кластеров всегда была одного порядка, несмотря на определенные различия в величине между экспериментами (рис. 5А).

Рис. 5. Средний урожай зерна восьми фенотипических кластеров пшеницы.

Кластеры были идентифицированы с помощью многофакторного анализа. Средние значения в контрольных обработках (A) и изменения в урожайности их зерна, выраженные в% от контроля при различных обработках тепловым стрессом (B). C— Контроль, H5 h20 — h25— Тепловой стресс продолжительностью 5, 10 и 15 дней; ZD49 — стадия загрузки, ZD59 — заголовок, ZD72 — раннее развитие молока.

https://doi.org/10.1371/journal.pone.0222639.g005

В дополнение к общим моделям реакции для урожайности зерна были отмечены специфические для обработки различия между ответами различных кластеров, которые лучше всего можно было визуализировать как среднее снижение урожайности, выраженное как% от средних контрольных значений для каждый кластер (рис. 5B). Таким образом, стало очевидно, что существуют различия в чувствительности к тепловому стрессу отдельных кластеров на разных этапах развития, независимо от величины их способности к плодоношению.Из трех наиболее урожайных кластеров (Clu1, 2 и 3) чувствительность Clu2 всегда была наибольшей и была более выраженной в двух более ранних фазах развития. При ZD49 Clu3 оказался наиболее устойчивым к тепловому стрессу, тогда как Clu1 показал лучшие результаты при ZD72. Из трех промежуточных кластеров (Clu6, 7 и 8) Clu8 был лучшим во всех трех фазах развития, тогда как Clu6 показал наибольшую чувствительность к теплу в двух более ранних фазах развития (ZD49 и ZD59), а не только в промежуточных кластерах. но также и во всех восьми кластерах.Тепловая чувствительность самого низкоурожайного Clu4 была промежуточной для ранней и поздней фаз развития, но была одной из лучших в ZD59. Однако тепловая чувствительность Clu5 увеличивается в более поздних фазах развития, в результате чего эта группа становится наиболее чувствительной на ZD72.

За исключением веса тысячи зерен (как в основном колосе, так и в среднем по всем колосам), наблюдались значительные различия в компонентах урожайности между гроздьями, как при контрольной обработке, так и при обработке тепловым стрессом (S3, рис.).Данные показали, что большое количество зерен на основной и средний колос было основой высокого урожая зерна как для Clu1, так и для Clu3 в контрольных вариантах, тогда как большое количество репродуктивных побегов было наиболее решающим параметром для Clu2. В контроле большее количество репродуктивных побегов Clu2 было способно компенсировать меньшее количество семян, но в условиях теплового стресса даже стабильное образование RT в фазах ZD49 и ZD72 не могло противодействовать резкому уменьшению количества семян.При тепловом стрессе Clu3 был лучше способен сохранять свое количество семян на ранних фазах развития, особенно в главном колосе, тогда как эта способность становилась сильнее у Clu1 на более поздних фазах развития. Среди промежуточных кластеров наибольший интерес представляют реакции Clu6 и Clu8. Закладка семян Clu6 была наиболее чувствительной к тепловому стрессу, что приводило к сильно уменьшенному количеству семян как в главном колосе, так и в боковых колосках, что было характерно для этой группы на более ранних этапах развития (ZD49, ZD59).Однако способность Clu8 поддерживать как RT, так и количество семян была хорошей в условиях теплового стресса, особенно при ZD49.

Обсуждение

Положительные и отрицательные аспекты экспериментов в контролируемых и / или полевых условиях ранее подробно обсуждались в большом количестве публикаций [56–59]. Исследования показали, что результаты непросто перенести из теплицы в поле. Одной из наших целей в этом эксперименте было изучение эффектов теплового стресса в конкретных и четко определенных фазах развития, чтобы установить, как чувствительность к теплу изменяется по мере развития растений.Кроме того, эта работа была выполнена на большем количестве генотипов пшеницы с разными моделями развития (окно даты заголовка составляло примерно 14 дней в популяции). Этот тип систематических исследований невозможно провести в полевых условиях, потому что время, продолжительность тепла или единственный фактор стресса можно легко контролировать. Этот же набор сортов пшеницы является компонентом долгосрочной исследовательской программы, в которой связи между развитием растений и компонентами урожайности планируются для изучения в полевых условиях в течение более длительного периода времени с учетом различных климатических факторов (результаты первого трехлетнего диапазона недавно были опубликованы Kiss et al.[60]). Таким образом, показатели чувствительности к тепловому стрессу сортов, выращенных в контролируемых условиях, впоследствии могут быть включены во временной анализ.

Ущерб, вызванный тепловым стрессом, зависит как от времени, так и от продолжительности стресса. Однако в большинстве экспериментов, проведенных до сих пор, рассматривается только один из этих аспектов, или в исследованиях задействовано лишь ограниченное количество генотипов [61–64]. В текущем систематическом эксперименте, проведенном со 101 сортом пшеницы, учитывались оба аспекта теплового стресса.Кроме того, эксперименты проводились в контролируемой среде, чтобы гарантировать, что каждый генотип подвергался тепловому стрессу в одной и той же фазе развития, тем самым исключая мешающие факторы в полевых экспериментах, где тепловой стресс влияет на генотипы пшеницы на разных этапах развития [62 ]. Чтобы изучить время теплового стресса, были протестированы три различные стадии развития, все они произошли после мейотического деления в мужских и женских соцветиях. Сочетание трех фенофаз и трех периодов теплового стресса означало, что развитие растений происходило в стрессовых условиях в течение разного времени.Когда тепловой стресс начался на стадии выращивания (ZD49), период развития в условиях стресса варьировался от колошения (5-дневный тепловой стресс) через цветение и опыление (10-дневный тепловой стресс) до завязывания семян и раннего развития семян (15-дневный тепловой стресс). стресс). В случае ZD59 (заголовок) этот диапазон простирался от цветения и опыления через завязку семян до раннего заделки семян, а в случае ZD72 (6 день после колошения) — от заделки семян через раннее засыпание семян до позднего развития семян. . Этот сценарий привел к специфическим изменениям, которые имели более сильную характеристику и значительное влияние, особенно на признаки, связанные с урожаем, чем различия, выявленные между генотипическими реакциями.Используя эту экспериментальную установку, оба аспекта теплового стресса оказались очень важными детерминантами различных морфологических, связанных с урожайностью и физиологических признаков.

Настоящее исследование подтверждает результаты предыдущих исследований, согласно которым характеристики, связанные с урожайностью, снижаются с увеличением продолжительности теплового стресса (5, 10 и 15 дней) независимо от фазы развития, когда происходит тепловой стресс [24,49–51,65]. Пяти дней теплового стресса было достаточно, чтобы значительно снизить большинство признаков, связанных с урожайностью, тогда как 15-дневный тепловой стресс привел к наибольшему снижению.Наиболее термочувствительным оказался период после фенофазы ZD59. Обработки, которые больше всего отличались от контроля, были ZD59_h20 и ZD59_h25, что указывает на то, что тепловой стресс оказывал наибольшее влияние на урожайность сортов озимой пшеницы на этой стадии развития. В подтверждение с другими исследованиями было обнаружено, что на этом этапе отрицательно сказывается не только завязка семян, но и масса тысячи зерен, сопровождаемая сильным снижением биомассы и числа репродуктивных побегов [22,40,63,64,66– 69].Общее снижение урожайности зерна в ZD49 и ZD72 было одинаковым, но это было связано со специфическими и разнообразными изменениями в индивидуальных характеристиках компонентов урожая. Тепловой стресс, возникающий после завязывания семян, в основном влияет на эффективность наполнения зерна, что приводит к снижению веса тысячи зерен пропорционально продолжительности теплового стресса. Однако на этом этапе тепло само по себе меньше влияло на количество семян и количество репродуктивных побегов, если вода была оптимально доступна. Напротив, когда тепловой стресс происходил перед колошением, уменьшение количества семян сопровождалось увеличением как массы тысячи зерен, так и количества репродуктивных побегов, что в определенной степени уравновешивало потерю урожая.Этот компенсирующий эффект был наиболее выражен после короткого периода нагрева и постепенно исчезал по мере увеличения продолжительности нагрева.

В этом исследовании были изучены различные физиологические признаки, связанные с фотосинтетической активностью листьев флага в условиях контроля и теплового стресса, чтобы определить их роль в устойчивости к тепловому стрессу [32,62]. Хотя фенотипические различия были отмечены среди генотипов пшеницы по всем физиологическим параметрам, это оказалось незначительным по сравнению с эффектом продолжительности теплового стресса, который сам по себе объяснял большинство фенотипических вариаций.Это открытие подчеркивает тот факт, что физиологические изменения были в первую очередь общей реакцией на тепловой стресс у разных генотипов. Результаты, полученные в настоящей работе, показали, что ускоренное старение флаговых листьев, вызванное тепловым стрессом, может быть связано с более низким уровнем фотосинтетических пигментов и снижением фотосинтетической активности.

Из-за снижения фотосинтетической активности, которая становилась более выраженной с возрастом растений, сетевая ассимиляция и устьичная проводимость постепенно снижались с увеличением продолжительности теплового стресса.Однако термическая обработка вызвала значительное увеличение испарения, которое было более интенсивным у молодых растений, особенно при более коротком периоде теплового стресса, демонстрируя, что если вода была доступна в почве, первая общая реакция растений на тепло заключалась в охлаждении их. ткани за счет усиленного испарения. Косвенным доказательством этого является одно наблюдение: генотипы с большей биомассой и, следовательно, с большей площадью испарения, как правило, лучше переносили тепло, как предполагают Reynolds et al.[39]. Интересно отметить, что повышенное испарение произошло, несмотря на сильное снижение устьичной проводимости, не связанное с фенофазой. Хотя устьичная проводимость снизилась из-за теплового стресса, полного закрытия, которое могло бы предотвратить транспирацию, не произошло. Sharma et al. [55] сообщили о схожих результатах, в которых у термочувствительных сортов пшеницы наблюдалась пониженная устьичная проводимость с сильно увеличенной транспирацией. В нашем случае большинство сортов показали этот тип реакции, и несколько исключений были рассредоточены по всем кластерам теплового отклика, подчеркивая, что не существует сильной связи между устьичной проводимостью, испарением и устойчивостью к тепловому стрессу в этой популяции пшеницы.Поскольку экспериментальные условия представляли собой жаркую и влажную среду [53–55], это явление не могло быть вызвано дефицитом давления пара. Одно из возможных объяснений отсутствия корреляции может заключаться в том, что сорта пшеницы, изученные в этой работе, были выбраны без каких-либо предварительных знаний об их транспирационных характеристиках, а их устойчивость к тепловому стрессу была установлена ​​путем снижения урожайности зерна. Это наблюдение контрастирует с исследованием Sharma et al.[55], которые сравнили генотипы пшеницы, которые были ранее отобраны для максимизации различий в устьичной проводимости и испарении. Среди физиологических параметров только содержание хлорофилла в флаговых листьях показало сильную связь как с генотипом, так и с фазой развития. Тенденции, выявленные в этой работе, хорошо согласуются с предыдущими исследованиями [29,31]. Однако в текущей экспериментальной установке генотипические различия в содержании хлорофилла не коррелировали ни с реакцией на тепловой стресс, ни с признаками, связанными с урожайностью, как также было обнаружено Али и соавт.[61].

Таким образом, у 101 протестированного сорта пшеницы не было выявлено значительной связи между различными параметрами фотосинтетической активности и урожайностью зерна или между фотосинтетической активностью и устойчивостью к тепловому стрессу. Это общее отсутствие значимых ассоциаций между физиологическими параметрами и устойчивостью к тепловому стрессу противоречит избранным данным из литературы, где было обнаружено, что различные параметры фотосинтетической активности связаны с устойчивостью к тепловому стрессу [55,64,70–72].Причина этого несоответствия может заключаться в разном количестве исследованных генотипов, генетической структуре популяций или способе воздействия теплового стресса. Текущая работа охватывала более широкий спектр генотипов пшеницы разного географического происхождения, тогда как обработка тепловым стрессом применялась точно на одной и той же фазе развития для каждого генотипа.

Одной из основных целей этого исследования было измерение устойчивости к тепловому стрессу большого набора генотипов озимой пшеницы для характеристики степени и типа ответов и выявления генотипов с более высоким уровнем устойчивости к тепловому стрессу.Изучая влияние стадии развития и продолжительности обработки термическим стрессом, мы обнаружили, что сорта с более высоким урожаем зерна в контрольных условиях также имели тенденцию иметь более высокий урожай зерна в условиях теплового стресса. Однако, несмотря на это наблюдение, урожайность не совпадала с чувствительностью к тепловому стрессу, выраженной как% снижения выхода контрольного зерна. Мы также обнаружили, что генотипы различались по своей фенофазно-специфической чувствительности к теплу, которая в некоторых случаях не совпадала со средними тенденциями.На основе урожайности на разных этапах развития и лечения теплового стресса можно выделить восемь основных групп ответа генотипов пшеницы. Из них три группы (Clu1, Clu3 и Clu8) были определены как представляющие интерес для дальнейших исследований. Из двух групп с высоким урожаем зерна Clu1 имел лучшую устойчивость к тепловому стрессу на ранней стадии развития (ZD49), тогда как группа Clu3 была лучшей в последней фазе развития (ZD72). Переносимость теплового стресса в промежуточной группе Clu8 была одной из лучших на более ранних этапах развития (ZD49 и ZD59).Между членами этих трех групп были инициированы скрещивания, частично для целей разведения, а частично для дальнейших исследований с целью определения генетического фона реакции на тепловой стресс.

Таким образом, результаты позволили описать степень чувствительности на различных фазах развития в большей популяции сортов пшеницы и идентифицировать типы реакций с повышением термостойкости. В дальнейших исследованиях эти результаты могут способствовать созданию сортов с лучшей термостойкостью.Очевидно, что необходимо изучить более широкое генетическое разнообразие, если мы хотим добиться большей устойчивости к тепловому стрессу в программах селекции пшеницы.

Вспомогательная информация

S1 Таблица. Список сортов озимой пшеницы, включенных в эксперименты с тепловым стрессом, сгруппирован на основе их характеристик реакции на тепловой стресс, которые были установлены с использованием кластерного анализа и анализа главных компонентов (PCA).

Положение каждого сорта среди и внутри кластеров в этой таблице полностью соответствует его положению на тепловой карте урожайности зерна (по строкам на рис. 4).

https://doi.org/10.1371/journal.pone.0222639.s001

(PDF)

S2 Рис. 101 сорта озимой пшеницы, разделенные на восемь фенотипических кластеров.

Кластеризация проводилась на основе корреляции урожайности зерна с PCA. Разные цветные числа соответствуют различным группам на основе термостойкости, идентифицированным с помощью иерархического кластерного анализа.

https://doi.org/10.1371/journal.pone.0222639.s004

(PDF)

Ссылки

  1. 1.Надь Б.А., Борос Т. Политика в отношении изменения климата в Венгрии, Резюме. Политические решения, Friedrich Ebert Stiftung. Ноябрь 2011 г. Доступно по адресу: http://www.fesbp.hu/common/pdf/Climate_Change_Policy.pdf Цитировано 31 мая 2019 г.
  2. 2. Кумудини С., Андраде Ф.Х., Буте К.Дж., Браун Г.А., Дзотси К.А., Эдмиадс Г.О. и др. Прогнозирование фенологии кукурузы: сравнение функций реакции развития на температуру. Агрон Дж. 2014; 106: 2087–2097.
  3. 3. Хэтфилд Дж. Л., Прюгер Дж. Х.Перепады температур: влияние на рост и развитие растений. Weather Clim Extrem. 2015; 10: 4–10.
  4. 4. Lakatos M, Szépszó G, Bihari Z, Krüzselyi I, Szabó P, Bartholy J, et al. Экстремальные климатические изменения в Венгрии: недавнее и будущее. Резюме результатов Венгрии в связи с тематическим отчетом о рисках и управлении экстремальными климатическими явлениями в МГЭИК 2012 г. 29 февраля 2012 г. Доступно по ссылке: https://www.met.hu/doc/IPCC_jelentes/HREX_jelentes-2012.pdf Цитировано 31 мая 2019 г.
  5. 5. Вахид А., Гелани С., Ашраф М., Фулад М. Теплостойкость растений: обзор. Environ Exp Bot. 2007. 61: 199–223.
  6. 6. Резаи Э., Уэббер Х., Гайзер Т., Нааб Дж., Эверт Ф. Тепловой стресс в зерновых: механизмы и моделирование. Eur J Agron. 2015; 64: 98–113.
  7. 7. Каушал Н., Бхандари К., Сиддик К. Х., Найяр Х. Продовольственные культуры сталкиваются с повышением температуры: обзор реакций, адаптивных механизмов и подходов к повышению термостойкости. Cogent Food Agric.2016; 2.
  8. 8. Портер Дж. Р., Гавит М. Температура и рост и развитие пшеницы: обзор. Eur J Agron. 1999; 10: 23–36.
  9. 9. Феррис Р. Влияние высокотемпературного стресса при цветении на урожай зерна и биомассу полевых культур пшеницы. Энн Бот. 1998. 82: 631–639.
  10. 10. Семенов М.А., Портер-мл. Климатическая изменчивость и моделирование урожайности сельскохозяйственных культур. Agric для Meteorol. 1995. 73: 265–283.
  11. 11. Кобза Дж., Эдвардс Г.Е.Влияние температуры листьев на фотосинтетический углеродный обмен у пшеницы. Plant Physiol. 1987. 83: 69–74. pmid: 16665218
  12. 12. Чоудхури SI, Wardlaw IF. Влияние температуры на развитие ядра зерновых культур. Aust J Agric Res. 1978; 29: 205–223.
  13. 13. Теволд Х, Фернандес CJ, Эриксон CA. Сорта пшеницы адаптированы к высокотемпературному стрессу после уборки урожая. J Agron Crop Sci. 2006; 192: 111–120.
  14. 14. Фишер Р.А. Количество зерен в посевах пшеницы и влияние солнечной радиации и температуры.J Agric Sci. 1985; 105: 447–461.
  15. 15. Ортис-Монастерио I, Диллон СС, Фишер Р.А. Дата воздействия посева на урожай зерна и компоненты урожайности орошаемых сортов яровой пшеницы и взаимосвязь с радиацией и температурой в Лудхиане, Индия. Полевые культуры Res. 1994; 37: 169–184.
  16. 16. Макмастер GS. Фенология, развитие и рост верхушки побега пшеницы ( Triticum aestivum L.): обзор. Adv Agron. 1997; 59: 63–118.
  17. 17.Сайни Х.С., Аспиналл Д. Влияние дефицита воды на спорогенез у пшеницы ( Triticum aestivum L.). Энн Бот. 1981; 48: 623–633.
  18. 18. Сайни Х.С., Седжли М., Аспиналл Д. Влияние теплового стресса во время развития цветков на рост пыльцевых трубок и анатомию яичников у пшеницы ( Triticum aestivum L.). Aust J Plant Physiol. 1983; 10: 137–144.
  19. 19. Волленвебер Б., Портер Дж. Р., Шеллберг Дж. Отсутствие взаимодействия между экстремально высокими температурами на стадиях вегетативного и репродуктивного роста пшеницы.J Agron Crop Sci. 2003. 189: 142–150.
  20. 20. Лобелл Д. Б., Шленкер В., Коста-Робертс Дж. Климатические тенденции и мировое растениеводство с 1980 года. Наука. 2011; 333: 616–620. pmid: 21551030
  21. 21. Stone PJ, Николас ME. Сорта пшеницы сильно различаются по своей реакции урожайности и качества зерна на короткие периоды теплового стресса после цветения. Aust J Plant Physiol. 1994; 21: 887–900.
  22. 22. Stone PJ, Николас ME. Влияние сроков теплового стресса при наливе зерна на два сорта пшеницы, различающихся жаростойкостью.I. Рост зерна. Aust J Plant Physiol. 1995; 22: 927–934.
  23. 23. Талукдер ASMHM McDonald GK, Gill GS. Влияние кратковременного теплового стресса перед цветением и ранним завязыванием зерна на урожайность зерна пшеницы. Полевые культуры Res. 2014; 160: 54–63.
  24. 24. Stone PJ, Николас ME. Исследование влияния высоких температур во время налива зерна на урожайность и качество 75 сортов пшеницы. Aust J Agric Res. 1995; 46: 475–492.
  25. 25. Рахман М.А., Чикуши Дж., Йошида С., Карим А.Компоненты роста и урожайности генотипов пшеницы, подвергшихся высокотемпературному стрессу в контролируемой среде. Бангладеш J Agric Res. 2009. 34: 360–372.
  26. 26. Инь X, Го В., Спирц Дж. Х. Количественный подход к характеристике взаимоотношений между поглотителем и источником во время налива зерна в контрастных генотипах пшеницы. Полевые культуры Res. 2009. 114: 119–126.
  27. 27. Виньевич М., Ван Х, Олесен Дж. Э., Волленвебер Б. Признаки у сортов яровой пшеницы, связанные с потерей урожая, вызванной эпизодом теплового стресса после цветения.J Agron Crop Sci. 2015; 201: 32–48.
  28. 28. Ян Дж., Сирс Р.Г., Гилл Б.С., Полсен Г.М. Характеристики роста и старения, связанные с толерантностью чужеродных амфиплоидов пшеницы к высокой температуре в контролируемых условиях. Euphytica. 2002; 126: 185–193.
  29. 29. Шах Н.Х., Полсен GM. Взаимодействие засухи и высокой температуры на фотосинтез и насыпку зерна пшеницы. Почва растений. 2003. 257: 219–226.
  30. 30. Хардинг С.А., Гикема Дж. А., Полсен GM.Снижение фотосинтеза из-за высокотемпературного стресса во время созревания пшеницы: II. Взаимодействие с процессами источника и приемника. Plant Physiol. 1990; 92: 654–658. pmid: 16667330
  31. 31. Лю Б., Ассенг С., Ван А., Ван С., Тан Л., Цао В. и др. Моделирование воздействия теплового стресса после уборки урожая на рост биомассы озимой пшеницы. Agric для Meteorol. 2017; 247: 476–490.
  32. 32. Джанагираман М, Бойл Д.Л., Велти Р., Джагадиш СВК, Прасад ПВВ. Снижение скорости фотосинтеза пшеницы при высоких температурах связано с десатурацией липидов, окислением, ацилированием и повреждением органелл.BMC Plant Biol. 2018; 18: 55. pmid: 29621997
  33. 33. Ристич З, Буковник У, Прасад ПВВ. Корреляция между термостабильностью тилакоидных мембран и потерей хлорофилла у озимой пшеницы при тепловом стрессе. Crop Sci. 2007; 47: 2067–2073.
  34. 34. Хан С.У., Гурмани А.Р., Кайюм А., Хан Х. Оценка термостойкости генотипов пшеницы ( Triticum aestivum L.) на основе некоторых потенциальных индикаторов термостойкости. J Chem Soc Pak. 2013; 35: 647–653.
  35. 35.Ян Дж., Чжан Дж., Ван З., Чжу К., Лю Л. Старение, вызванное дефицитом воды, и его связь с ремобилизацией предварительно накопленного углерода в пшенице во время налива зерна. Агрон Дж. 2001; 93: 196–206.
  36. 36. Грегерсен П.Л., Холм ПБ. Транскриптомный анализ старения флагового листа пшеницы ( Triticum aestivum L.). Plant Biotechnol J. 2007; 5: 192–206. pmid: 17207268
  37. 37. Аль-Хатиб К., Полсен GM. Режим высокотемпературного поражения пшеницы при развитии зерна.Physiol Plant. 1984. 61: 363–368.
  38. 38. Хардинг С.А., Гикема Дж. А., Полсен GM. Снижение фотосинтеза из-за высокотемпературного стресса во время созревания пшеницы. Взаимодействие с процессами старения. Plant Physiol. 1990; 92: 648–653. pmid: 16667329
  39. 39. Рейнольдс М.П., ​​Дельгадо М.Б., Гутьеррес-Родригес М., Ларк-Сааведра А. Фотосинтез пшеницы в теплой орошаемой среде I: генетическое разнообразие и продуктивность сельскохозяйственных культур. Полевые культуры Res. 2000; 66: 37–50.
  40. 40.Лю Б., Ассенг С., Лю Л., Тан Л., Цао В., Чжу Ю. Тестирование реакции четырех моделей урожая пшеницы на тепловой стресс при цветении и наливе зерна. Glob Chang Biol. 2016; 22: 1890–1903. pmid: 26725507
  41. 41. Бхуллар С.С., Дженнер С.Ф. Дифференциальная реакция на высокие температуры накопления крахмала и азота в зерне четырех сортов пшеницы. Aust J Plant Physiol. 1985; 12: 363–375.
  42. 42. Фарук М., Брамли Х., Палта Дж. А., Сиддик К. Х.М. Тепловой стресс у пшеницы во время репродуктивной фазы и фазы налива зерна.Crit Rev Plant Sci. 2011; 30: 491–507.
  43. 43. Salvucci ME, Crafts-Brandner SJ. Ингибирование фотосинтеза тепловым стрессом: состояние активации Рубиско как лимитирующий фактор фотосинтеза. Physiol Plant. 2004. 120: 179–186. pmid: 15032851
  44. 44. Сюй XL, Чжан YH, Ван ZM. Влияние теплового стресса при наливе зерна на активность фосфоенолпируваткарбоксилазы и рибулозо-1,5-бисфосфаткарбоксилазы / оксигеназы различных зеленых органов озимой пшеницы.Фотосинтетика. 2004. 42: 317–320.
  45. 45. Камехо Д., Родригес П., Моралес М.А., Делль’Амико Дж. М., Торресильяс А., Аларкон Дж. Дж. Влияние высоких температур на фотосинтетическую активность двух сортов томатов с разной температурной восприимчивостью. J. Plant Physiol. 2005. 162: 281–289. pmid: 15832680
  46. 46. Фэн Б., Лю П, Ли Дж, Донг С.Т., Ван Ф.Х., Конг Л.А. и др. Влияние теплового стресса на фотосинтетические характеристики флаговых листьев на стадии налива зерна у различных жаростойких сортов озимой пшеницы.J Agron Crop Sci. 2014; 200: 143–155.
  47. 47. Прасад ПВВ, Писипати С.Р., Момчилович И., Ристич З. Независимые и комбинированные эффекты стресса от высокой температуры и засухи во время насыпи зерна на урожай растений и экспрессию EF-Tu хлоропластов в яровой пшенице. J Agron Crop Sci. 2011; 197: 430–441.
  48. 48. Махрукашани А., Зиберт С., Хюгинг Х., Эверт Ф. Независимые и комбинированные эффекты воздействия высокой температуры и засухи вокруг цветков на пшеницу. J Agron Crop Sci.2017; 203: 453–463.
  49. 49. Балла К., Бедё З, Вейс О. Влияние жары и засухи на фотосинтетические процессы пшеницы. Cereal Res Commun. 2006; 34: 381–384.
  50. 50. Балла К., Бедо З, Вейс О. Изучение физиологических и агрономических признаков озимой пшеницы в условиях недостатка воды. Cereal Res Commun. 2008. 36: 1103–1106.
  51. 51. Балла К., Ракшеги М., Ли З., Бекеш Ф., Бенче С., Вейс О. Качество озимой пшеницы в зависимости от шока жары и засухи после цветения.Чешский J Food Sci. 2011; 29: 117–128.
  52. 52. Тоттман Д. Р., Мейкпис Р. Дж., Броуд Х. Объяснение десятичного кода для стадий роста злаков с иллюстрациями. Ann Appl Biol. 1979; 93: 221–234.
  53. 53. Рашид М.А., Андерсен М.Н., Волленвебер Б., Кёруп К., Чжан Х, Олесен Дж. Э. Влияние аномальной жары с высоким и низким VPD на фотосинтетические компоненты пшеницы и их восстановление. Environ Exp Bot. 2018; 147: 138–146.
  54. 54. Рашид М.А., Андерсен М.Н., Волленвебер Б., Чжан Х, Олесен Дж. Э.Акклиматизация к более высоким УД и температуре минимизировала негативное влияние на ассимиляцию и урожай зерна пшеницы. Agric для Meteorol. 2018; 248: 119–129.
  55. 55. Шарма Д.К., Андерсен С.Б., Оттосен С.О., Розенквист Э. Сорта пшеницы, отобранные для высокого Fv / Fm в условиях теплового стресса, сохраняют высокий фотосинтез, общий хлорофилл, устьичную проводимость, транспирацию и содержание сухого вещества. Physiol Plant. 2015; 153: 284–298. pmid: 24962705
  56. 56. Brilli F, Hörtnagl L, Hammerle A, Haslwanter A, Hansel A, Loreto F и др.Реакция листьев и экосистемы на доступность воды в почве на горных лугах. Agric для Meteorol. 2011; 151: 1731–1740. pmid: 24465071
  57. 57. Фудзимура С., Ши П., Ивама К., Чжан Х, Гопал Дж., Джитсуяма Ю. Влияние увеличения СО2 на рост и урожай пшеницы при различных атмосферных давлениях и их взаимодействие с температурой. Plant Prod Sci. 2012; 15: 118–124.
  58. 58. Бита С.Е., Герац Т. Устойчивость растений к высоким температурам в изменяющейся окружающей среде: научные основы и получение устойчивых к тепловому стрессу культур.Фронтальный завод им. 2013; 4: 273. pmid: 23

    3

  59. 59. Главацова М., Поханкова Е., Клем К., Хлавинка П., Трнка М. Влияние стресса засухи на отдельные компоненты формирования урожая озимой пшеницы в планах горшечных и полевых экспериментов. В: Polák O, Cerkal R, Belcredi NB, Horký P, Vacek P, редакторы. Материалы международной конференции аспирантов. MendelNet; 2016. С. 63–68.
  60. 60. Поцелуй Т., Баньяи Дж., Балла К., Майер М., Берки З., Хорват Б. и др. Сравнительное изучение особенностей развития и компонентов урожайности мягкой пшеницы в полевых условиях в многолетних многосевных временных экспериментах.Crop Sci. 2019; 59: 591–604.
  61. 61. Али МБ, Ибрагим AMH, Малла С., Радд Дж., Хейс ДБ. Семейное картирование QTL устойчивости к тепловому стрессу у примитивной тетраплоидной пшеницы ( Triticum turgidum L.). Euphytica. 2013; 192: 189–203.
  62. 62. Коссани CM, Рейнольдс MP. Адаптация к тепловому стрессу у элитных линий синтетической гексаплоидной пшеницы. Crop Sci. 2015; 55: 2719–2735.
  63. 63. Barber HM, Lukac M, Simmonds J, Semenov MA, Gooding MJ.Временные и генетически дискретные периоды чувствительности пшеницы к высокой температуре. Фронтальный завод им. 2017; 8: 51. pmid: 28179910
  64. 64. Бергкамп Б., Импа С.М., Асебедо А.Р., Фриц А.К., Джагадиш СВК. Известные сорта озимой пшеницы реагируют на тепловой стресс после цветения в контролируемых камерах и полевых тепловых палатках. Полевые культуры Res. 2018; 222: 143–152.
  65. 65. Prasad PVV, Djanaguiraman M. Реакция плодородия цветков и индивидуальной массы зерна пшеницы на высокотемпературный стресс: чувствительные стадии и пороговые значения температуры и продолжительности.Funct Plant Biol. 2014; 41: 1261–1269.
  66. 66. Prasad PVV, Pisipati SR, Mutava RN, Tuinstra MR. Чувствительность зерна Sorghum к высокотемпературному стрессу в период репродуктивного развития. Crop Sci. 2008; 48: 1911–1917.
  67. 67. Рэндалл П.Дж., Мосс Х.Дж. Некоторые влияния температурного режима при наливе зерна на качество пшеницы. Aust J Agric Res. 1990; 41: 603–617.
  68. 68. Wardlaw IF. Влияние высокой температуры на развитие зерна у пшеницы: изменчивость, связанная с условиями перед колосом и после цветения.Aust J Plant Physiol. 1994; 21: 731–739.
  69. 69. Stone PJ, Николас ME. Сравнение внезапного теплового стресса с постепенным воздействием высокой температуры при наливе зерна у двух сортов пшеницы, различающихся термостойкостью. I. Рост зерна. Aust J Plant Physiol. 1995; 22: 935–944.
  70. 70. Блюменталь С.С., Бекеш Ф., Бейти И.Л., Ригли К.В., Мосс Х.Дж., Марес Д.Дж. и др. Интерпретация результатов сортоиспытаний пшеницы по качеству зерна применительно к высокотемпературному стрессу.Aust J Agric Res. 1991; 42: 325–334.
  71. 71. Ширдельмоганлоо Х., Коццолино Д., Лохрасеб И., Коллинз, Северная Каролина. Усечение зерна пшеницы ( Triticum aestivum ), вызванное кратковременным тепловым стрессом во время раннего налива зерна: связь с реакцией старения и сокращением запасов стебля. Funct Plant Biol. 2016; 43: 919–930.
  72. 72. Камрани М., Хосейни Ю., Эбадоллахи А. Оценка устойчивости к тепловому стрессу у генотипов твердой пшеницы с использованием индексов стрессоустойчивости.Arch Agron Soil Sci. 2017; 64: 38–45.

Влияние азота и серы на качество озимой твердой пшеницы и концентрацию аспарагина

Концентрация и состав белка в зерне являются ключевыми факторами, влияющими на качество озимой пшеницы, и зависят от генотипа пшеницы, доступного плодородия и условий выращивания. Эти же параметры могут повлиять на концентрацию свободного аспарагина в зерне, а повышенный уровень аспарагина может привести к образованию акриламида в выпеченных пищевых продуктах, что может быть опасно для здоровья.Цели этого исследования состояли в том, чтобы определить влияние генотипа, фертильности азота (N) и серы (S) на концентрацию белка, качество белка, реологию теста и концентрацию аспарагина в озимой пшенице, выращиваемой на почвах с дефицитом серы. Обработки были организованы по факторному плану 3 × 2 × 4 в 2017 году и факторному плану 3 × 2 × 5 в 2018 году. Было три уровня N (56, 101 и 146 кг га −1 ), два уровня S ( 0 и 22 кг га −1 ), четыре уровня генотипа в 2017 году и пять уровней генотипа в 2018 году.Белковый состав оценивался как процентное содержание полимерного белка с использованием гель-фильтрационной высокоэффективной жидкостной хроматографии. В оба года соотношение полимерного и мономерного белка увеличивалось за счет внесения серных удобрений. Удерживающая способность растворителя (SRC) оценивалась с использованием теста цельнозерновой молочной кислоты и додецилсульфата натрия. В 2018 году приложение S увеличило SRC на 217–308%. Однако в 2017 году улучшение SRC было ограничено двумя генотипами и было умеренным, вероятно, вследствие снижения концентрации белка на участках, обработанных S.Концентрация свободного аспарагина составляла в среднем 9,8 мкмоль / г и 20,9 мкмоль / г в 2017 и 2018 годах соответственно. На концентрацию аспарагина в зерне влияли N, S, генотип и их взаимодействия. Применение серы существенно снизило концентрацию аспарагина за оба года. Реология теста оценивалась в испытании 2018 года с помощью теста фаринографа. Применение серы увеличило среднюю стабильность фаринографа с 9,2 мин до 14,6 мин. Стабильность фаринографа была эффективно предсказана тестом SRC (R 2 = 0.78). Эти результаты демонстрируют важность обеспечения адекватного фертильности S при производстве озимой пшеницы.

Аллельная вариация генов яровизации и фотопериодной реакции в разнообразном наборе генотипов озимой пшеницы в высоких широтах Северной Америки

PLoS One. 2018; 13 (8): e0203068.

, Концептуализация, Курирование данных, Формальный анализ, Исследование, Методология, Визуализация, Написание — первоначальный проект, # 1 , Концептуализация, Формальный анализ, Исследование, Методология, Визуализация, Написание — первоначальный проект, Написание — просмотр и редактирование, # 1 , Ресурсы, Написание — просмотр и редактирование, 2 , Ресурсы, Написание — обзор и редактирование, 3 и, Концептуализация, Формальный анализ, Ресурсы, Надзор, Проверка, Визуализация, Написание — просмотр и редактирование 1, *

Александр Уиттал

1 Департамент растениеводства, Университет Гвельфа, Гвельф, Онтарио, Канада

Мина Кавиани

1 Департамент растениеводства, Университет Гвельфа, Гвельф, Онтарио, Канада

Роберт Граф

2 Agriculture and Agri-Food Canada, Lethbridge Research Center, Летбридж, Альберта, Канада

Гэвин Хамфрис

3 Agriculture and Agri-Food Canada, Оттавский научно-исследовательский центр, Оттава, Онтарио, Канада

Алиреза Наваби

1 Департамент растениеводства, Университет Гвельфа, Гвельф, Онтарио, Канада

Аймин Чжан, редактор

1 Департамент растениеводства, Университет Гвельфа, Гвельф, Онтарио, Канада

2 Agriculture and Agri-Food Canada, Lethbridge Research Center, Летбридж, Альберта, Канада

3 Сельское хозяйство и агропродовольствие Канада, Оттавский научно-исследовательский центр, Оттава, Онтарио, Канада

Институт генетики и биологии развития Китайской академии наук, КИТАЙ

# Внесен равный вклад.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Поступило 09.04.2018 г .; Принято 14 августа 2018 г.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника. другими статьями в PMC.
Дополнительные материалы
S1 Файл: Новые грунтовки VRN-A1.Последовательность, использованная для конструирования новых праймеров VRN-A1 и изображение геля QIAxcel, показывающее продукты ПЦР для новых праймеров VRN-A1 .

(XLSX)

GUID: DEB27DDD-4E31-446A-8192-0930B5C934D8

S2 Файл: Полевые данные и данные генотипирования. Исходные данные фенологии, урожайности и генотипирования.

(PDF)

GUID: DD2EEF4B-A927-4705-AE13-95A33159FFB6

Заявление о доступности данных

Все соответствующие данные находятся в документе и его вспомогательных информационных файлах.

Реферат

Основные физиологические детерминанты фенологии пшеницы ( Triticum aestivum L.) в данном районе — это реакция на температуру яровизации и продолжительность дня, которые, по крайней мере частично, регулируются аллельными вариациями в яровизированный ( VRN ) и фотопериодный ( PPD ) локусы соответственно. Характеристика существующей генетической изменчивости фенологии растений озимой пшеницы может помочь селекционным программам улучшить адаптацию к местным условиям и оптимизировать фенологию пшеницы с учетом меняющегося климата.Цели этого исследования состояли в том, чтобы охарактеризовать аллельные вариации в основных локусах VRN и PPD в разнообразной панели генотипов озимой пшеницы в высоких широтах (n = 203) и связать аллельные вариации с фенологическими, агрономическими и адаптационными признаками. . Панель была генотипирована с использованием аллель-специфических маркеров при яровизации ( VRN-A1 , VRN-B1 , VRN-D1 и VRN-B3 ) и фотопериода ( PPD-A1 , PPD-B1 и PPD-D1 ) локусов и фенотипированы по агрономически важным признакам.Хотя фотопериодическая чувствительность была более распространенной, большая часть вариации фенологии панели озимой пшеницы объяснялась аллельной вариацией на PPD-D1 , PPD-A1 и взаимодействием между этими локусами. В то время как типичный высокоширотный генотип озимой пшеницы — это тот, который несет зимние аллели по всем основным локусам VRN и чувствительные к фотопериоду аллели по основным локусам PPD , в более низких широтах, где зимы более мягкие, наличие одного или двух нечувствительных к фотопериоду аллелей кажется, способствует более высокой урожайности и более широкой адаптации.

Введение

Пшеница ( Triticum aestivum L.) и другие родственные виды злаков умеренного пояса могут расти в широком диапазоне агроклиматических регионов [1]. Ключевым фактором, лежащим в основе этой успешной широкой адаптации, является изменчивость сроков важных биологических событий, которая обеспечивает способность избегать стресса в разные сезоны [2]. Например, пшеница может оптимально координировать время цветения с изменением сезона, чтобы избежать отрицательных температур, теплового стресса и стресса от засухи, которые потенциально могут повредить цветочные органы [2,3,4].Местные селекционные программы могут использовать преимущества генетической изменчивости, управляющей этими адаптивными механизмами, для отбора сортов, соответствующих их существующей среде выращивания; тем самым создавая сорта, устойчивые к будущим изменениям климата [5].

Время цветения пшеницы определяется двумя основными и хорошо описанными факторами окружающей среды: низкой температурой и фотопериодом, которые делят генотипы пшеницы на зимние или весенние (с требованием яровизации или без них) и нечувствительность к фотопериоду и чувствительность [6].Основными генетическими факторами, влияющими на такие фенологические характеристики у пшеницы, являются гены реакции яровизации ( VRN ), контролирующие необходимость холодного периода для перехода от вегетативной фазы к репродуктивной [7], а также гены фотопериодической чувствительности ( PPD ). , определяющие реакцию растений на длину светового дня [8,9].

Три основных гена, VRN-1 , VRN-2 и VRN-3 , контролируют потребность в яровизации пшеницы. VRN-1 и VRN-3 вызывают цветение при доминировании, причем VRN-1 оказывает основное влияние на переход верхушки из вегетативной фазы в репродуктивную, в то время как рецессивные мутанты VRN -2 ускоряют цветение [ 10,11,12,13,14,15].Серия генов VRN-1 включает три гомеологичных локуса VRN-A1 , VRN-B1 и VRN-D1 на длинном плече хромосом 5A, 5B и 5D соответственно [8,10, 16]. О большем полиморфизме в областях промотора, экзона 1 и интрона 1 сообщалось для VRN-A1 по сравнению с VRN-B1 и VRN-D1 [11,12,17]. Примечательно, что мутации в промоторной области VRN-A1 ( Vrn-A1a ) и интроне 1 ( Vrn-A1b и Vrn-A1c ) и большие делеции в интроне 1 VRN-B1 и Гены VRN-D1 были связаны с привычкой к весеннему росту, тогда как наличие интактного гомозиготного рецессивного аллеля vrn-A1 придает привычку к зимнему росту [11,12].

После выполнения требований к яровизации озимой пшеницы реакция светового периода будет контролировать время цветения [2]. Фотопериодическая реакция у пшеницы в основном контролируется локусами PHOTOPERIOD1 (PPD-1) , расположенными на коротких плечах хромосом 2A, 2B и 2D (8). PPD-1 генов, идентифицированных в пшенице и ячмене, являются членами семейства регуляторов псевдоответа (PRR) [18,19]. У каждого локуса есть аллели, которые определяют, имеет ли растение чувствительный к фотопериоду (длинный день) или нечувствительный (нейтральный день) фенотип.Генотипы, содержащие аллель, нечувствительный к фотопериоду (суффикс « a », например, Ppd-A1a ), будут цвести независимо от продолжительности светового дня, однако генотипы, чувствительные к фотопериоду (суффикс « b »), будут задерживаться во время короткие дни и переходят к репродуктивной стадии, когда длина светового дня увеличивается. Нечувствительность к фотопериоду в основном контролируется доминантным аллелем Ppd-D1a , за которым следуют аллели Ppd-B1a и Ppd-A1a [6,9].

Комбинации аллелей в локусах VRN-1, и PPD-1 , как сообщается, приводят к вариациям агрономических признаков и физиологического развития, таких как время цветения [20,21,22], кущение, количество колосков и высота растения [9,23,24].

Влияние аллельной изменчивости в локусах VRN-1, и PPD-1 на дату колошения было изучено в западных регионах Канады для коллекций яровой пшеницы [25,26,27] и нескольких коллекций яровой и озимой пшеницы. в других странах [6,28,29].Большинство вариаций даты колошения в коллекциях яровой пшеницы можно объяснить аллельными вариациями в локусах VRN-1 [25,26,27]. Напротив, Ppd-D1 , Ppd-B1 и их взаимодействие были ответственны за изменение даты колошения для коллекций озимой пшеницы, изученных на Великих равнинах США [29]. Исследование 683 линий из Европы, Азии, Африки, Америки и Австралии показало, что зимние и весенние аллели в локусе VRN-D1 не оказали значительного влияния на колошение [6].В исследовании также изучалось влияние чувствительных и нечувствительных к фотопериоду аллелей в локусах PPD-B1 и PPD-D1 , которые оказали значительное влияние на дату заголовка, при этом линии, чувствительные к фотопериоду, показали более позднее заголовок.

Ввиду важности влияния этих локусов на время цветения, изучение аллельных вариаций в этих локусах по отношению к фенологии растений поможет определить, какие комбинации аллелей наиболее полезны в конкретном регионе произрастания или в оптимизации фенологии растений для изменения климат.Определение оптимальных комбинаций аллелей облегчит отбор с помощью маркеров в программах селекции, чтобы избежать появления нежелательных комбинаций аллелей. Цели этого исследования состояли в том, чтобы (i) определить генетические вариации в локусах VRN и PPD в разнообразном наборе генотипов пшеницы и (ii) изучить фенологию растений под влиянием генотипов VRN / PPD осенью. — выращенный урожай в высокоширотных регионах выращивания озимой пшеницы в Онтарио, Канада. Эти анализы позволят лучше понять роль генов яровизации и фотопериода в определении сроков цветения и созревания озимой пшеницы в северных широтах.

Материалы и методы

Растительный материал

Растительный материал состоял из панели разнообразия из 203 генотипов озимой пшеницы в двух подгруппах. Первая подгруппа, обозначенная как VRN144, состояла из 144 записей, включая линии, которые в настоящее время выращиваются как озимая пшеница, адаптированная для Канады (70 записей) и других частей мира (3 записи), а также элитные линии (66 записей). ) в настоящее время находится на продвинутой стадии тестирования в программах разведения или в региональных испытаниях производительности в Онтарио, Канада.Вторая панель, обозначенная VRN64, включала коммерческие сорта озимой пшеницы из канадских прерий (39 записей) и 25 холодоустойчивых генотипов яровой пшеницы, разработанных в Центре исследований и разработок Летбриджа (LeRDC), Agriculture and Agri-Food Canada (AAFC). в Альберте, Канада. Холодоустойчивые яровые генотипы были получены непосредственно из озимых путем весенних скрещиваний или скрещивания ранее охарактеризованных холодоустойчивых линий яровой пшеницы. Отбор по особенностям весеннего роста и повышенной выживаемости происходил в течение нескольких поколений.Между двумя субпанелями было пять общих генотипов, содержащих в общей сложности 203 уникальных генотипа.

Окружающая среда и экспериментальный план

В 2014–2015 годах образцы оценивались на исследовательской станции Университета Гуэлф в Элоре около Элора, Онтарио, Канада (43 ° 38′N 80 ° 25′W). Субпанель VRN144 была создана в виде частично сбалансированной квадратной решетки 12 × 12 с двумя повторами. Субпанель VRN64 была посажена в том же поле с частично сбалансированной квадратной решеткой 8 × 8 с двумя повторениями.Каждая экспериментальная единица представляла собой двухрядный участок, засаженный плотностью 400 семян -2 , длиной 1,5 м, междурядьем 17,8 см и переулком 0,5 м, разделяющим участки, с расстоянием 35 см между соседними участками.

В сезоне 2015–2016 гг. Панель разнообразия была размещена в двух местах; исследовательская станция Элора и исследовательская станция Вудсток (43 ° 15′N 80 ° 78′W) около Вудстока, Онтарио, Канада, соответственно. Использовались те же статистические модели, что и для вегетационного периода 2014–2015 гг. Каждая экспериментальная схема представляла собой шестирядный участок длиной 4 м, с 17 участками.Междурядье 8 см и 2-метровая дорожка, разделяющая участки.

Фенотипическая оценка

Данные о зимней выживаемости были записаны в апреле по шкале от 0 до 10, где 0 означает, что растения не выжили, а 10 означает, что выжило 100% растений. Стадии развития сельскохозяйственных культур (всходы, колошение и цветение) определяли для каждого участка поля по шкале Задокса [30]. Количество дней до начала загрузки (стадия 41) было записано, когда у 75% побегов на участке флаговый лист был полностью раскрыт, оболочка флагового листа начала открываться и головка стала видна внутри оболочки.Количество дней до колошения (стадия 59) было зарегистрировано, когда 75% побегов на участке имели полный рост колосьев. Количество дней до цветения (стадия 61) регистрировали, когда у 75% побегов на участке пыльники были выдавлены из соцветий. Регистрировали количество дней до физиологической зрелости (стадия 87), когда цветоносы у 75% побегов на участке окрашивались. Период наполнения зерна (GFP) измеряли путем вычитания дней до цветения из дней до созревания. Заготовки собирали комбайном Wintersteiger (Wintersteiger, Ried im Innkreis, Австрия).Урожай зерна, тестовый вес и содержание влаги на каждой делянке собирали при сборе урожая с использованием Grain Gage HarvestMaster (Juniper Systems, Inc., Логан, Юта). Независимо от диапазона зрелости генотипов, все участки собирали одновременно, так как не было случая, когда ранний сорт мог разрушиться. Затем данные по урожайности были скорректированы до содержания влаги 14% для каждой экспериментальной единицы в соответствии с влажностью, измеренной во время сбора урожая.

Генотипирование

ПЦР-амплификация аллель-специфических маркеров
ДНК

экстрагировали из свежерастущих проростков.Четыре растения каждого генотипа, выращенные в течение недели на 96-луночных лотках с ватными шариками, поливали ежедневно в течение пяти дней. Через пять дней после прорастания листовую ткань четырех растений разрезали на более мелкие кусочки и измельчали ​​с использованием синего микропестика Eppendorf (Eppendorf, Гамбург, Германия) в пробирке на 1,5 мл. Экстракция ДНК следовала протоколу цетилтриметиламмония бромида (CTAB) [31]. Качество и количество ДНК оценивали путем определения A260 нм и A280 нм с помощью спектрофотометра NanoDrop (ND-1000) (NanoDrop Technologies, Уилмингтон, Делавэр, США).

Генотипирование проводили с использованием 7 аллель-специфичных маркеров ПЦР (). Набор праймеров VrnN_FP3 / R3 был разработан Primer Express Software (Applied Biosystems). ПЦР-анализы проводили в 96-луночных полукруглых ПЦР-планшетах Fisherbrand 96-луночные планшеты (Thermofisher, Mississauga, ON, Canada) с использованием Mastercycler Pro (Eppendorf, Гамбург, Германия) с 25 мкл реакционной смеси, состоящей из 3-4 мкл 50 нг мкл -1 матричной ДНК и 1X Taq PCR Master Mix (Qiagen, Мэриленд, США). Циклы ПЦР проводили в соответствии с условиями, указанными в опубликованных отчетах ().Продукты ПЦР фракционировали по размеру и визуализировали с использованием системы QIAxcel Advanced (QIAGEN GmBH, Hilden, Германия).

Таблица 1

Аллель-специфические маркеры для аллелей основных генов яровизации и фотопериодного ответа, последовательность праймеров, размер продукта ПЦР, температура отжига и цитирование маркеров, используемых в этом исследовании для использования генотипирования.

9 9295 PPD-B1 929 04 6704 57 92 976 ATGTCTGCCAATTAGCTAGC
Локус Аллель (ы) Название праймера Последовательность [5′-3 ‘] Размер продукта (п.о.) Температура отжига (° C) Ссылка
ППФ-A1 TaPpd-A1prodelF CGTACTCCCTCCGTTTCTTT 57 32
PPD-А1а TaPpd-A1prodelR3 AATTTACGGGGACCAAATACC 338 ( Ppd-A1a )
Ppd-A1b TaPpd-A1prodelR2 GTTGGGGTCGTT76-G470 GTTGGGGTCGTT76-462
Ppd-B1a TaPpd-B1proinF1 CAGCTCCTCCGTTTGCTTCC 650 ( Ppd-B1a ) 60 32
Ppd-B1b TaPpd-B1proinR1 92 CAG16AGGAGTG1 92 CAG16AGGAG86
ППФ-D1 + PPD-D1_F1 ACGCCTCCCACTACACTG 54 19
PPD-D1a + PPD-D1_R2 CACTGGTGGTAGCTGAGATT 288 ( Ppd-D1a )
Ppd-D1b Ppd-D1_R1 GTA42976 Ppd-D1_R1 GTA42976 GTA86GAG70TAG GTA42976 GTA42976
VRN-A1 Vrn-A1a VrnN_FP3 GTGTGTGTTTGTGGCGAG AG 926 ( Vrn-A1a ) 55 в этом исследовании 1
Vrn-A1b VrnN_RP16GG 91GAT VrnN_R76G86G 91GA85 VrnN_RP16GG )
vrn-A1 662 ( vrn-A1 ) 704 76 56
Внутренний / B / F CAAGTGGAACGGTTAGGACA 709 ( Vrn-B1a ) 58 12
9295
CTCATGCCAAAAATTGAAGATGA 673 ( Vrn-B1b )
vrn-B1 Intr704 976 / F 91 CAAGTGGAACGGTTAGGACA 1149 56.4 12
Intr1 / B / R4 CAAATGAAAAGGAATGAGAGCA 57 56
56 F GTTGTCTGCCTCATCAAATCC 61 12
Intr1 / D / R3 GGTCACTGGTGGTCTGTGC 1671
VRN-D1 + Intr1 / D / R AAATGAAAAGGAACGAGAGCG 997
VRN-B3 91-704 VRN-B3 91-704 VRN-B3 91-704 Vrn-B3 9705 VRN-B3-B3-B3-B3-B3 1200 57 10
VRN4-B-INS-R
VRN-В3 VRN4-BNOINS-F ATGCTTTCGCTTGCCATCC 1140 57 10
VRN4-BNOINS-R CTATCCCTACCGGCCATTAG

Анализ данных

Кластерный анализ

Генотипы, которые имели гетерогенные или неопределенные локусные аллели, были удалены из всех аллелей кластера.Генотипические данные для 203 генотипов были подвергнуты кластерному анализу. Генотипические данные были импортированы в программу Graphical Genotype (GGT 2.0; [32]), в которой вычислялась матрица попарных генетических дистанций. Затем эта матрица была сохранена как файл MEGA. Затем матрица несходства была экспортирована в программу MEGA 7.0 [33], где был рассчитан метод невзвешенной парной группы с дендрограммой среднего арифметического и дендрограмма была сгенерирована с использованием команды «Построить / протестировать дерево UPGMA» на вкладке филогении.

Градус-дни

Суммарные градус-дни (CGDD) рассчитывались как количество дневных степеней роста, полученных для достижения различных фенологических стадий (зародыш, колошение, цветение и физиологическая зрелость) с использованием формулы, объясненной Макмастером и Смикой. , 1988 [34]. Уравнение для расчета GDD:

GGD = ∑i = 1p [(DailyMaxTemp + DailyMinTemp) ÷ 2] −4

где i - это номер дня в диапазоне от первого безморозного дня в каждом сезоне (10 апреля -го в Элоре 2015 и 15 апреля -го в испытаниях 2016 года) до p -го -го дня, в котором была зарегистрирована соответствующая фенологическая стадия.

Дисперсионный анализ

Дисперсионный анализ фенотипических данных проводили с использованием процедуры PROC MIXED в SAS 9.4 (SAS Institute, Inc., Кэри, Северная Каролина). Анализ смешанной модели проводился на исходных данных для определения значимости фиксированных (генотип) и случайных (блок, неполный блок в блоке, среда и их взаимодействия) факторов. Средние наименьшие квадраты (Lsmeans) для генотипов были вычислены с использованием инструкции LSMEANS. Тесты на нормальность остатков были выполнены с использованием процедуры Шапиро Уилка [35], Колмогорова-Смирнова [36,37], Крамера-фон Мизеса [37] и Андерсона-Дарлинга [38,39] в процедуре PROC UNIVARITA SAS.График разброса стьюдентизированных остатков по сравнению с предсказанными значениями был создан в PROC GPLOT для изучения случайного и независимого распределения остатков.

Статистическая значимость генотипических групп в каждом из VRN и PPD локусов была исследована с использованием линейной смешанной модели в процедуре PROC MIXED SAS, в которой фенотипическая ценность была исследована как линейная функция генотипа на каждый локус. Если генотипы были гетерогенными или неидентифицированными для определенного локуса, они исключались из анализа локуса.Локусы PPD-B1 , VRN-B1 , VRN-D1 и VRN-B3 не тестировались на фенологические признаки из-за отсутствия вариации в этих локусах. Коэффициенты корреляции фенологических признаков Пирсона были рассчитаны с использованием процедуры PROC CORR в SAS.

Анализ основных компонентов был выполнен для изучения взаимосвязи между наблюдаемыми чертами с использованием PROC PRINCOMP и PRINQUAL в SAS. Биплоты были созданы с использованием значений ПК1 и ПК2 в качестве осей x и y соответственно.

Коробчатые диаграммы были созданы в программном обеспечении Sigma-plot (Systat Software Inc., Ричмонд, Калифорния) с использованием функции прямоугольной диаграммы. Усы прямоугольной диаграммы простираются до 10 -го и 90 -го процентилей. Точки данных, выходящие за пределы усов, считаются выбросами.

Результаты

Генотипирование

Частота аллелей в
VRN-1 и PPD-1 локусов

Анализ панели разнообразия (n = 203) с 7 ген-специфическими маркерами () показал, что PPD-D1 Локус имел наибольшую аллельную изменчивость среди трех локусов чувствительности к фотопериоду: 127 генотипов, несущих чувствительный к фотопериоду аллель Ppd-D1b , и 68 генотипов, несущие нечувствительный к фотопериоду аллель Ppd-D1a ().Локус со вторым по величине изменением был PPD-A1 , в котором 170 генотипов несли чувствительный к фотопериоду аллель Ppd-A1b , а 31 генотип несли нечувствительный к фотопериоду аллель Ppd-A1a (). Локус PPD-B1 не имел каких-либо аллельных вариаций, так что все 203 генотипа несли чувствительный к фотопериоду аллель Ppd-B1b ().

Таблица 2

Частота генотипов с разным фотопериодом и аллелями яровизации в основных локусах для 203 генотипов на панели разнообразия.

-A1
Число генотипов (%)
Локус Нечувствительный a / Весна b Чувствительный a / Зимний b PP
31 (15,0%) 170 (84,0%) 2 (1,0%)
PPD-B1 0 203 (100,0%) 0 7 9704 9704 0 7 9705 PPD-D1 68 (33.5%) 127 (62,5%) 8 (4,0%)
VRN-A1 18 (9,0%) 182 (89,0%) 2 (1,0%)
VRN-B1 1 (0,5%) 201 (99,0%) 1 (0,5%)
VRN-D1 1 (0,5%) 202 (99,5%) 0
VRN-B3 0 203 (100,0%) 0

VRN-A1 показал большую вариабельность по сравнению с другими тестированными локусами яровизации с 182 основными генотипами. рецессивный зимний аллель vrn-A1 и 18 генотипов, несущих весенний аллель Vrn-A1a ().За исключением одного генотипа, несущего весенний аллель Vrn-B1 , остальная часть зародышевой плазмы (201 запись) несла рецессивный аллель vrn-B1 (). Низкая вариабельность была обнаружена для локуса VRN-D1 . Большинство генотипов (202 записи) несли рецессивный аллель vrn-D1 winter; только один генотип несет весенний аллель Vrn-D1 (). В зародышевой плазме не было никаких изменений в локусе VRN-B3 , при этом все 203 генотипа несли рецессивный аллель vrn-B3 ().

Кластерный анализ

Кластерный анализ 203 генотипов выявил шесть отдельных кластеров на основе их генотипов в основных локусах VRN и PPD с использованием данных аллель-специфичных маркеров (). Самый большой кластер (показан зеленым, n = 85) состоял из генотипов с аллелями, чувствительными к фотопериоду, по всем трем основным локусам PPD , Ppd-A1b / Ppd-B1b / Ppd-D1b и рецессивным зимним аллелям все три локуса VRN-1 , vrn-A1 / vrn-B1 / vrn-D1 , а также зимний аллель vrn-B3 .Второй по величине кластер (показан фиолетовым,; n = 55) имел нечувствительный к фотопериоду аллель Ppd-D1a , чувствительный к фотопериоду Ppd-A1b и Ppd-B1b аллели и чувствительный к яровизации vrn- Аллели A1 , vrn-B1 , vrn-D1 и vrn-B3 в локусах VRN-1 ().

Дендрограмма комбинаций локусов генотипа.

По часовой стрелке ; Ppd-A1b / Ppd-B1b / Ppd-D1b / vrn-A1 / vrn-B1 / vrn-D1 / vrn-B3 (зеленый), Ppd-A1b / Ppd-B1b / Ppd-D1b / Vrn-A1a / vrn -B1 / vrn-D1 / vrn-B3 (красный), Ppd-A1a / Ppd-B1b / Ppd-D1b / vrn-A1 / vrn-B1 / vrn-D1 / vrn-B3 (синий) , Ppd -A1a / Ppd-B1b / Ppd-D1a / vrn-A1 / vrn-B1 / vrn-D1 / vrn-B3 (желтый), Ppd-A1b / Ppd-B1b / Ppd-D1a / vrn-A1 / vrn- B1 / vrn-D1 / vrn-B3 (фиолетовый), Ppd-A1b / Ppd-B1b / Ppd-D1b / vrn-A1 / Vrn-B1 / Vrn-D1 / vrn-B3 (розовый).

Следующий кластер (показан синим,; n = 18) имел нечувствительный к фотопериоду аллель Ppd-A1a и чувствительные аллели Ppd-B1b и Ppd-D1b , а также рецессивные зимние аллели. ; vrn-A1 / vrn-B1 / vrn-D1 / vrn-B3 . Другой кластер (показан желтым,; n = 12) имел нечувствительные к фотопериоду аллели Ppd-A1a и Ppd-D1a , но чувствительный аллель Ppd-B1b и чувствительные к зиме аллели vrn-A1 , vrn-B1 , vrn-D1 и vrn-B3 ().Большинство сортов канадской озимой пшеницы сгруппированы в эти четыре группы; все несли рецессивные зимние аллели в VRN - A1 , VRN-B1 , VRN-D1 и VRN - B3 локусов в дополнение к фотопериодочувствительным аллелям в одном, двух или всех три основных локуса PPD ().

Остальные генотипы несли по крайней мере один весенний аллель в одном из трех основных локусов VRN . Самый большой кластер этого типа, содержащий весенние аллели (показаны красным,; n = 18), имел чувствительные к фотопериоду аллели Ppd-A1b , Ppd-B1b и Ppd-D1b и чувствительные к зиме. аллели vrn-B1 , vrn-D1 и vrn-B3 , но весенний аллель Vrn-A1a .Эти генотипы являются исключительно зимостойкими весенними линиями из Альберты, Канада (), которые были отобраны для поддержания осеннего вегетативного роста и весеннего роста, а также зимостойкости. Шестой и самый маленький кластер (показан розовым,; n = 1) - это чек яровой пшеницы в тесте, который содержал чувствительные к фотопериоду аллели Ppd-D1b и Ppd-A1b , а также озимые аллели vrn. -A 1 и vrn-B3, но имели весенние аллели; Vrn-B1 и Vrn-D1 локусов ().

Влияние аллельной изменчивости в локусах
VRN-1, и PPD-1 на фенотипические признаки

Значительные различия (P = <0,001) наблюдались среди генотипов по урожайности, высоте растений, GFP, массе тысячи ядер. (TKW) и для количества дней роста, необходимых для достижения начальной загрузки, заголовка, цветения и зрелости (). Эффект взаимодействия «генотип за средой» (G × E) был значительным (P = <0,001) для всех признаков, предполагая, что генотипы по-разному реагировали на среду ().Фенотипические различия генотипов с разными аллелями в локусах VRN и PPD были изучены в отдельных анализах смешанных моделей (). Ppd-D1b и Ppd-A1b были связаны с 38,78 и 36,52 GDD, которые позже загружались в комбинированном анализе в разных средах, по сравнению с нечувствительными к фотопериоду линиями, несущими Ppd-D1a и Ppd-A1a , соответственно (). Этот паттерн повторяется для GDD в заголовок и цветение для записей с нечувствительными аллелями в локусах PPD-D1 и PPD-A1 (,).Средний эффект Ppd-D1b составил 36,29 GDD позже для заголовка и 34,21 GDD позже для записей с Ppd-A1b по сравнению с записями с нечувствительными аллелями (,). Напротив, генотипы с Ppd-D1b достигли цветения на 35,68 дней позже, в то время как записи с Ppd-A1b достигли цветения на 31,19 дней позже, чем генотипы с нечувствительными аллелями (,). Однако генотипы с разными аллелями в локусе VRN-A1 не отличались по количеству GDD от загрузки, заголовка и цветения (,).

Коробчатые диаграммы, представляющие частотное распределение генотипов в трех генотипических группах Ppd-A1 , Ppd-D1 и Vrn-A1 для фенотипических признаков, наблюдаемых в полевых испытаниях в 2015 и 2016 годах в Онтарио, Канада.

*, ** и *** представляют значимые различия при 0,05, 0,01 и 0,001 соответственно. n = количество генотипов в каждой группе. На каждой прямоугольной диаграмме сплошные точки представляют выбросы. Каждое поле представляет собой межквартильный диапазон, который содержит 50% значений.Усы - это линии, которые простираются от прямоугольника до самого высокого и самого низкого значений, за исключением выбросов. Пунктирные и сплошные линии в рамке обозначают медианное и среднее значение соответственно. GDD: Дни повышения квалификации. TKW: Вес тысячи ядер (г). GFP: период наполнения зерна.

Таблица 3

Смешанный модельный анализ дисперсии 208 генотипов в панели разнообразия для фенотипических признаков, наблюдаемых в полевых испытаниях 2015 и 2016 годов, посаженных в районах Элора и Вудсток, Онтарио.

(фиксированный эффект DF = 207, эффект Loci DF = 1).


Fue Fue 33 *** Оценка 9140 00 00 00 * Окружающая среда 6 F -Значение 6 9295 4 ***
GDD 1 до загрузки от GDD до заголовка от GDD до Anthesis GFP 2 GDD до погашения 9295 9295 Высота 9295 9295 9295 9295 9295 9295 9295 9295 F -Значение F -Значение F -Значение F -Значение F -Значение F -Значение F -Значение
Фиксированное действие
11,86 *** 13,11 *** 2,17 *** 3,66 *** 3,60 *** 1,85 *** 11,92 ***
Оценка Оценка Оценка Оценка Оценка Оценка Оценка Оценка Оценка
Окружающая среда 2651.25 нс 4 2991,42 нс 3808,15 нс 4867,41 нс 17151,00 нс 0,82 нс 116,44 нс 34,56 нс
34,56 нс
34,56 нс
3,97 нс 0,00 0,00 0,00 0,04 нс 1,42 нс
iBlock (блок env * ) 18,69 *** 204704 4 4 4 18.25 ** 379,58 *** 374,58 *** 0,27 *** 0,47 ** 4,57 ***
197,32 *** 239,98 *** 155,60 *** 880,66 *** 1313,47 *** *** 0,30 0,30 0,30 7,94 *** 8.59 ***
Остаток 156,83 *** 149,57 *** 161,15 *** 681,43 *** 03 92

92

0,38 *** 6,11 *** 13,62 ***
Loci F -Значение F 57 -Value Значение F -Значение F -Значение F -Значение F -Значение F -Значение
30,65 *** 37,21 *** 0,68 нс 11,91 *** 16,73 *** 0,37 нс 28704 946 929 ***
Ppd-A1 19,75 *** 15,47 *** 14,81 *** 5,61 ** 3704 4 1,09704 1,07 4.20 * 2.89 нс 8,03 ***
Vrn-A1 1,30 нс 0,96 нс 0,71 нс 14,99 .09 *** *** 0,10 нс 12,09 ***
Ppd-D1 * Ppd-A1 5,40 ** 21982
21982 *
0.15 нс 1,12 нс 0,70 нс 0,33 нс 0,59 нс

Влияние аллельной изменчивости в локусе PPD-D1 не было значимым для GDD, необходимого для GFP (,). С другой стороны, генотипы с разными аллелями в локусе PPD-A1 значительно различались для GDD, необходимого для GFP (). Среднее значение GFP генотипов с Ppd-A1a или Ppd-A1b составило 516,47 и 497,44 GDD соответственно ().Точно так же генотипы с разными аллелями в локусе VRN-A1 значительно (P = <0,0001) различались для GDD, необходимого для GFP (таблицы и). Среднее значение GFP для генотипов с Vrn-A1a или vrn-A1 составило 469,15 и 504,09 GDD соответственно ().

Генотипы с разными аллелями в локусах PPD-D1 (P = <0,0001), PPD-A1 (P = 0,01) и VRN-A1 (P = <0,0001) значительно различались по урожайности ( ).Средняя урожайность генотипов с Ppd-D1a или Ppd-D1b составила 5,63 и 4,87 т га -1 соответственно (), в то время как генотипы с Ppd-A1a или Ppd-A1b в среднем дали 5,53 т га. и 5,03 т га -1 соответственно (). Средняя урожайность генотипов с Vrn-A1a или vrn-A1 составила 3,98 и 5,23 т га -1 соответственно ().

Генотипы с разными аллелями PPD-D1 (P = <0.0001), PPD-A1 (P = 0,0004) и VRN-A1 (P = <0,0001) значительно различались по высоте растений (). Средняя высота растений генотипов с аллелями Ppd-D1a или Ppd-D1b составляла 77,35 и 85,40 см соответственно (), в то время как средняя высота растений генотипов с аллелями Ppd-A1a или Ppd-A1b составляла 77,57 и 83,54 см соответственно (). Средняя высота растений генотипов с аллелями Vrn-A1a или vrn-A1 составляла 90.86 и 81,73 см соответственно ().

Корреляции и анализ основных компонентов

GDD для цветения был очень тесно связан с GDD для загрузки (r = 0,94) и GDD для заголовка (r = 0,96) в объединенном двухгодичном графике. Антезис и созревание были связаны (r = 0,73), но GDD с цветением и GFP не имели связи (r = 0,00) (). Зрелость была связана с GFP (r = 0,68), но не имела связи с доходностью (r = 0,01). GFP и урожай были тесно связаны (r = 0,35) (). Доходность имела положительную корреляцию с TKW (r = 0.3), но он имел отрицательную связь с высотой растения (r = -0,29) и GDD с цветением (r = -0,32) ().

Таблица 4

Коэффициент корреляции Пирсона (вверху) и вероятность их значимости (внизу) для парных фенотипических признаков, наблюдаемых в полевых испытаниях 2015 и 2016 годов в Элоре и Вудстоке.

9444 9444 9704 *** 47 47 47 47 47 47 47 44 946 944 944 944 944 944 944 944 944 944 944 ** 970424 -0,32 -0,32 ***
GDD 1 до Anthesis GDD для загрузки GFP 2 GDD в заголовок Высота GDD47 929 929 929 929 до погашения Выживание
GDD для загрузки 0.94
*** 944 944 4 944 944 944 944 944 944 944 944 4 0,00
ns 4 944 944 944 944 944 944 944 944 944 944 944 944 944 944 944 944 944 944 944 944 944 944 944 944 944 944 944 944 944 0.96 0,95 0,12
*** *** 244 244 4 9444 9704 4 9444 9704 4 9704 4
Высота 0,41 0,50 -0,30 0,36
4 9444 9444 ***
GDD до погашения 0.73 0,68 0,68 0,78 0,09
*** ***
***
TKW (г) 0,06 0,08 0,10 0,07 4 0,10 0,07 944 944 944 944 944 944 944 944 944 944 9444 944 нс нс нс нс *** нс
Winter Survival -0.24 -0,08 -0,40 -0,26 0,28 -0,45 0,03
*** *** *** нс
Урожайность (т га -1 ) 0.35 -0,27 -0,29 0,01 0,30 -0,04
*** *** 46

*** ns *** ns

Анализ основных компонентов (PCA) с GFP, TKW, ростом, урожайностью, зимней выживаемостью и фенологическими признаками 203 генотипов был выполнено, чтобы оценить, можно ли использовать эти переменные для дифференциации сортов с разными аллелями PPD-D1 и PPD-A1 ().На первые два основных компонента приходится 66,13% вариации. Компонент 1 положительно коррелировал с признаками GFP, TKW, высотой и фенологией и отрицательно коррелировал с урожайностью и зимней выживаемостью. Напротив, компонент 2 коррелировал только с доходностью, GFP, TKW и сроком погашения (). Двойной график первых двух основных компонентов разделял влияние чувствительности PPD вдоль оси PC1, при этом все чувствительные к фотопериоду генотипы группировались вместе (с некоторым перекрытием), группировались по направлению к зарослям, колошению, цветению, зрелости, GFP, высоте растения и TKW () .Напротив, генотипы с по крайней мере одним нечувствительным к световому периоду аллелем сгруппированы в основном в левой части двумерного графика, стремясь к более высокой урожайности и вдали от фенологических признаков (). Среди генотипов с аллелями, нечувствительными к фотопериоду, полностью нечувствительные проявляли большую тенденцию к урожайности ().

Двойной график анализа основных компонентов генотипа по матрицам признаков за 2015 и 2016 годы для 203 генотипов, протестированных в испытаниях с осенним посевом в Онтарио, Канада.

Обсуждение

Используя диагностические молекулярные маркеры для наиболее распространенных аллелей локусов VRN и PPD , влияющих на потребность в яровизации и фотопериодной реакции, мы охарактеризовали коллекцию зародышевой плазмы генотипов канадской озимой пшеницы, выращенных или разработанных для более высоких широт. регионы Северной Америки.Первой целью этого исследования было оценить аллельные вариации в важных локусах VRN и PPD . Анализ маркеров выявил высокую распространенность аллелей фотопериодной чувствительности в локусах PPD-D1 (62,5%), PPD-A1 (84%) и PPD-B1 (100%). Высокая частота Ppd-D1 чувствительных аллелей в более высоких широтах была ранее отмечена Guo et al. [40] в линиях, собранных из Канады и США во всемирной коллекции пшеницы (n = 492).Нечувствительный к фотопериоду аллель Ppd-D1b присутствовал на уровнях, аналогичных уровням, обнаруженным Kiss et al. [6] в линиях озимой пшеницы из Америки и Африки по сравнению с линиями с других континентов.

В зародышевой плазме, изученной в данном исследовании, мы наблюдали отсутствие вариаций в локусах VRN , что было сопоставимо с низкой частотой (2%) VRN - A1 в европейской коллекции озимой пшеницы 521 озимой пшеницы. генотипы пшеницы [6]. Яровые аллели Vrn-B1 и Vrn-D1 в их исследовании присутствовали с несколько более высокой частотой по сравнению с генотипами канадской озимой пшеницы.Отсутствие вариации в основных локусах VRN ожидалось, учитывая, что панель разнообразия почти полностью состояла из генотипов озимой пшеницы, адаптированных к канадским условиям.

Низкая изменчивость в локусе VRN-1 также наблюдалась в коллекции озимой пшеницы (n = 299) из Великих равнин США [29]. Однако они обнаружили более высокую частоту нечувствительных к фотопериоду аллелей у PPD-B1 (53%), редких случаев Ppd-A1a (2%) и сопоставимых Ppd-D1a (35%).Они указали, что сорта из северных Великих равнин имели более высокую распространенность аллелей, чувствительных к фотопериоду, чем зародышевая плазма из центральных и южных селекционных программ [29].

Многие генетические исследования показали, что сорта озимой и яровой пшеницы, выращиваемые в странах с северными широтами, обычно несут аллели, чувствительные к фотопериоду, с более высокой частотой. Напротив, генотипы, выращенные в южных широтах, обычно несут нечувствительные к фотопериоду аллели [9,28,29,41,42,43]. Вероятно, это связано с меньшими вариациями продолжительности дня в регионах южных широт, где нечувствительность к фотопериоду может иметь явное адаптивное значение [29,44].

Типичный канадский материал озимой пшеницы нес озимые аллели по всем основным локусам VRN и чувствительные к фотопериоду аллели по трем или двум из основных локусов PPD . Большинство генотипов имели аллельную комбинацию Ppd / Vrn из Ppd-A1b , Ppd-B1b , Ppd-D1b , vrn-A1 , vrn-B1 ,

56 vrn-D vrn-B3 , что составляет 43% комбинаций генотипов. Вторая по величине группа была аналогичной, за исключением того, что она несла Ppd-D1a вместо Ppd-D1b и составляла 28% генотипов.Генотипы со всеми тремя зимними аллелями VRN-1 и одним или несколькими нечувствительными аллелями Ppd составляют 42% от общего числа генотипов. Это указывает на то, что отбор в программах селекции озимой пшеницы в Канаде благоприятствовал отбору по аллелю (ам) чувствительности к фотопериоду в основных локусах PPD . Grogan et al. [29] также сообщили об увеличении селекции нечувствительных к фотопериоду аллелей по всей территории Великих равнин США после 2000 г. Они обнаружили более высокую частоту чувствительных к фотопериоду аллелей Ppd-A1b , Ppd-B1b и Ppd-D1b северные равнины по сравнению с центральными и южными равнинами [29].Напротив, Kamran et al. [26] сообщили, что у яровой пшеницы Западной Канады Ppd-D1b заменяется нечувствительным к фотопериоду аллелем Ppd-D1a в недавней зародышевой плазме.

Наша вторая цель состояла в том, чтобы изучить влияние вариаций VRN и PPD на фенологию растений в разнообразном наборе линий озимой и яровой пшеницы осеннего посева, которые представляют генетические вариации озимой пшеницы в более высоких широтах (> 40 °). N) Северной Америки.

Мы обнаружили, что гены фотопериода, чувствительные к длине дня, играют важную роль в определении времени цветения и приспособляемости канадской озимой пшеницы. Grogan et al. [29] обнаружили, что дата колошения озимой пшеницы с Великих равнин США сильно зависит от локусов фотопериода. Сходные результаты наблюдались в настоящем исследовании, в котором генотипы с различным аллелем (аллелями) Ppd-A1 / D1 имели разное время для загрузки, колошения, цветения, GFP и высоты. Как и ожидалось, нечувствительность к фотопериоду привела к более раннему цветению по сравнению с чувствительностью к фотопериоду.В среднем нечувствительные к длине дня генотипы требовали на 41,8 градусо-дней меньше, чем генотипы с чувствительными к фотопериоду аллелями по всем трем локусам PPD , чтобы достичь цветения. Результаты более раннего цветения нечувствительных к фотопериоду генотипов согласуются с результатами предыдущих исследований, в которых сообщалось, что начало зародыша и колошения было на 3,7 и 4,3 дня соответственно [6], а также на 1,6-8 дней раньше цветения [29,45], что обусловлено присутствием Аллель Ppd-D1a по сравнению с генотипами, чувствительными к фотопериоду.

Несмотря на более раннее цветение, генотипы с нечувствительным к фотопериоду аллелем Ppd-D1a в целом дали результат на 13,5% выше, чем генотипы, чувствительные к фотопериоду, по сравнению с генотипами с аллелем Ppd-D1b . Разница в доходности согласуется с другими отчетами; например, в южной Европе сообщалось о повышении урожайности до 35% для нечувствительных к фотопериоду генотипов, несущих аллель Ppd-D1a [9,45]. Аналогичным образом, урожайность генотипов с аллелем Ppd-D1a была выше на 7,7% в Германии и на 30% в бывшей Югославии [9].Более высокий урожай генотипов Ppd-D1a можно объяснить уходом из жарких и засушливых летних дней из-за более раннего цветения [9]. В этом исследовании более высокий урожай генотипов Ppd-D1a может быть связан с предотвращением биотических стрессов, связанных с мучнистой росой ( Erysiphe graminis ) и фузариозом (вызванным в основном Fusarium graminearum ), которые присутствовали в 2015 г. и полосовая ржавчина (вызванная Puccinia striiformis ) в 2016 г. [42,45].

Различия в генотипических группах по локусу VRN-A1 были значительными для GFP, роста и времени до созревания.Расширение GFP было связано с задержкой созревания среди генотипов vrn-A1 , в то время как две группы достигли цветения одновременно. Ускоренное время созревания генотипов Vrn-A1a согласуется с результатами исследования генотипов канадской твердой красной яровой пшеницы [26]. Vrn-A1a также вызывал более раннее цветение по сравнению с vrn-A1 [25, 26]; тем не менее, в этом исследовании количество дней до цветения существенно не различалось между двумя аллельными группами [26].Более низкая урожайность генотипов Vrn-A1a (холодостойкая яровая пшеница) может быть связана с тем, что панель имеет высокий процент высокоурожайных генотипов озимой пшеницы. Однако, исходя из влияния времени до созревания, генотипов vrn-A1 с отсроченным созреванием, возможно, продемонстрировали высокую урожайность из-за пролонгированного GFP. Кроме того, холодоустойчивые генотипы яровой пшеницы отбирались в первую очередь на основе зимостойкости без учета урожайности зерна.

Существует несколько теорий относительно того, почему весенние аллели в локусе VRN и нечувствительные к фотопериоду аллели в локусах PPD вызывают более раннее цветение.Davidson et al. [46] предположили, что ускоренное цветение произошло из-за ускорения развития от появления всходов до начала цветения. Нечувствительность к фотопериоду связана с подавлением PPD1 и усилением регуляции VRN3, что, в свою очередь, способствует цветению за счет индукции генов идентичности меристем [47,48]. Преждевременность также может быть вызвана сокращением необходимого накопления единиц тепла между прорастанием и удлинением стебля [49]. Основываясь на результатах настоящего исследования, комбинация описанных теорий может объяснить разницу во времени, необходимом для достижения загрузки, колошения и цветения, между нечувствительными к фотопериоду и чувствительными генотипами.

Выводы

Мы изучили панель из 208 генотипов озимой пшеницы, репрезентативных для современной и исторической канадской озимой пшеницы, чтобы оценить аллельное разнообразие и влияние яровизации и фотопериодных локусов на время колошения, а также на другие физиологические стадии. Мы обнаружили, что большая часть изменчивости фенологии посевов озимой пшеницы в более высоких широтах может быть объяснена аллельной изменчивостью в PPD-D1 , PPD-A1 и взаимодействием между этими локусами.Выбор нечувствительности к световому периоду при наличии зимних аллелей в локусах яровизации для регионов выращивания осенней пшеницы в высоких широтах северного полушария может обеспечить более широкую адаптацию к окружающей среде. Это результат раннего цветения из-за нечувствительности к световому периоду, что приводит к более высокому урожаю благодаря избеганию биотических и / или абиотических стрессовых факторов в конце сезона. Повышенная частота нечувствительных к фотопериоду аллелей у озимой пшеницы в более высоких широтах может стать более распространенной с более частым наступлением более мягких зим из-за изменения климата.Наше исследование также показывает, что селекция генотипов зимостойкой яровой пшеницы кажется достижимой для регионов с более мягкой зимой путем отбора одного ярового аллеля в одном из локусов VRN-1 ( VRN-B1 или VRN-D1 ) в сочетании. с аллелями, чувствительными к фотопериоду, по всем основным локусам PPD , что обеспечивает некоторую защиту цветочной меристемы во время осени наряду с приемлемым уровнем морозоустойчивости.

Вспомогательная информация

Файл S1
Новые праймеры VRN-A1.

Последовательность, использованная для создания новых праймеров VRN-A1 и изображение геля QIAxcel, показывающее продукты ПЦР для новых праймеров VRN-A1 .

(XLSX)

Файл S2
Полевые данные и данные генотипирования.

Необработанные данные фенологии, урожайности и генотипирования.

(PDF)

Благодарности

Авторы благодарны сотрудникам Программы селекции пшеницы Университета Гвельфа, Николасу Уилкеру, Катарине Босник, Мелинде Драммонд и Райану Костелло за их техническую поддержку, а также Министерству сельского хозяйства, продовольствия Онтарио и Сельские дела (OMAFRA) - Партнерство Университета Гвельфов, зерновых фермеров Онтарио, SeCan и Национальный совет по научным и инженерным исследованиям Канады (NSERC) за финансовую поддержку проекта.

Заявление о финансировании

Финансируется Министерством сельского хозяйства, продовольствия и сельских районов Онтарио (OMAFRA) Зерновые фермеры Онтарио, Канадский национальный совет по научным и инженерным исследованиям SeCan (NSERC).

Доступность данных

Все соответствующие данные находятся в документе и его файлах с вспомогательной информацией.

Список литературы

1. Дубковски Дж., Дворжак Дж. Пластичность генома - ключевой фактор успеха полиплоидной пшеницы в условиях одомашнивания. Наука. 2007 г.июнь 29; 316 (5833): 1862–6. 10.1126 / science.1143986 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 2. Фьельхейм С., Боден С., Треваскис Б. Роль сезонных реакций цветения в адаптации трав к умеренному климату. Границы растениеводства. 2014 г. август 29; 5: 431 10.3389 / fpls.2014.00431 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 3. Fowler DB, Breton G, Limin AE, Mahfoozi S, Sarhan F. Фотопериод и температурные взаимодействия регулируют индуцированную низкой температурой экспрессию генов в ячмене.Физиология растений. 2001 г. Декабрь 1; 127 (4): 1676–81. 10.1104 / pp.010483.1676 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 4. Kiss T, Balla K, Bányai J, Veisz O, Karsai I. Связи между густотой растений и компонентами урожайности при разном времени посева пшеницы (Triticum aestivum L.). Коммуникации по исследованию зерновых культур. 2017: 1–0. 0.1556 / 0806.45.2017.069 [Google Scholar] 5. Гуэдира М., Сюн М., Хао Ю.Ф., Джонсон Дж., Харрисон С., Маршалл Д. и др. QTL даты колошения у озимой пшеницы (Triticum aestivum L.) совпадают с основными генами развития VERNALIZATION1 и PHOTOPERIOD1. ПлоС один. 2016 г. Может 10; 11 (5): e0154242 10.1371 / journal.pone.0154242 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 6. Поцелуй Т., Балла К., Вейс О, Ланг Л., Бедо З, Гриффитс С. и др. Частоты аллелей в ответе на яровизацию VRN-A1, VRN-B1 и VRN-D1 и генах фотопериодной чувствительности PPD-B1 и PPD-D1 и их влияние на колошение в разнообразном наборе сортов пшеницы (Triticum aestivum L.). Молекулярное разведение.2014 г. август 1; 34 (2): 297–310. 10.1007 / s11032-014-0034-2 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 7. Дубцовский Дж., Лиявецкий Д., Аппендино Л., Транквилли Г. Сравнительное RFLP-картирование генов Triticum monococcum, контролирующих потребность в яровизации. Теоретическая и прикладная генетика. 1998 г. Октябрь 1; 97 (5–6): 968–75. 10.1007 / s001220050978 [CrossRef] [Google Scholar] 8. Law CN, Sutka J, Worland AJ. Генетическое исследование реакции на продолжительность светового дня у пшеницы. Наследственность. 1978 г. Октябрь; 41 (2): 185 10.1038 / hdy.1978.87 [CrossRef] [Google Scholar] 9. Worland AJ, Börner A, Korzun V, Li WM, Petrovic S, Sayers EJ. Влияние генов фотопериода на приспособляемость озимой пшеницы европейской. Euphytica. 1998 г. апрель 1; 100 (1–3): 385–94. [Google Scholar] 10. Ян Л., Лукоянов А., Транквилли Г., Хельгера М., Фахима Т., Дубковски Дж. Позиционное клонирование гена яровизации пшеницы VRN1. Труды Национальной академии наук. 2003 г. Может 13; 100 (10): 6263–8. 10.1073 / pnas.09100 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 11.Ян Л., Лукоянов А., Блечл А., Транкуилли Г., Рамакришна В., Сан Мигель П. и др. Ген пшеницы VRN2 представляет собой репрессор цветения, подавляемый яровизацией. Наука. 2004 г. Март 12; 303 (5664): 1640–4. 10.1126 / science.10 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 12. Fu D, Szcs P, Yan L, Helguera M, Skinner JS, Von Zitzewitz J, Hayes PM и др. Большие делеции в первом интроне VRN-1 связаны с привычкой к весеннему росту ячменя и пшеницы. Молекулярная генетика и геномика.2005 г. Март 1; 273 (1): 54–65. 0,1007 / s00438-004-1095-4 10.1007 / s00438-004-1095-4 [PubMed] [CrossRef] [Google Scholar] 13. Треваскис Б., Хемминг М.Н., Деннис Э.С., Пикок В.Дж. Молекулярные основы цветения злаков при яровизации. Тенденции в растениеводстве. 2007 г. август 1; 12 (8): 352–7. 10.1016 / j.tplants.2007.06.010 [PubMed] [CrossRef] [Google Scholar] 14. Дистельфельд А., Ли С., Дубковски Дж. Регулирование цветения зерновых культур умеренного пояса. Современное мнение в биологии растений. 2009 г. апрель 1; 12 (2): 178–84.10.1016 / j.pbi.2008.12.010 [PubMed] [CrossRef] [Google Scholar] 15. Trevaskis B. Центральная роль гена VERNALIZATION1 в реакции яровизации зерновых культур. Функциональная биология растений. 2010 г. июнь 10; 37 (6): 479–87. 10.1071 / FP10056 [CrossRef] [Google Scholar] 16. Pugsley AT. Дополнительные гены, подавляющие зимние привычки у пшеницы. Euphytica. 1972 г. Октябрь 1; 21 (3): 547–52. 10.1007 / BF00039355 [CrossRef] [Google Scholar] 17. Милец З., Сумикова Т., Томкова Л., Панкова К. Распределение различных аллелей Vrn-B1 в гексаплоидной зародышевой плазме яровой пшеницы.Euphytica. 2013. август 1; 192 (3): 371–8. 10.1007 / s10681-013-0863-9 [CrossRef] [Google Scholar] 18. Тернер А., Билс Дж., Фор С., Данфорд Р.П., Лори Д.А. Регулятор псевдоответа Ppd-h2 обеспечивает адаптацию к световому периоду ячменя. Наука. 2005 г. Ноябрь 11; 310 (5750): 1031–4. 10.1126 / science.1117619 [PubMed] [CrossRef] [Google Scholar] 19. Билс Дж., Тернер А., Гриффитс С., Снейп Дж. У., Лори Д. А.. Регулятор псевдоответа неправильно экспрессируется в нечувствительном к фотопериоду мутанте Ppd-D1a пшеницы (Triticum aestivum L.). Теоретическая и прикладная генетика. 2007 г. сентябрь 1; 115 (5): 721–33. 10.1007 / s00122-007-0603-4 [PubMed] [CrossRef] [Google Scholar] 20. Икбал М., Наваби А., Лосось Д.Ф., Ян Р.С., Спанер Д. Генетическое исследование раннего цветения и зрелости канадской яровой пшеницы. Канадский журнал растениеводства. 2006 г. Октябрь 10; 86 (4): 995–1004. 10.1139 / G07-028 [CrossRef] [Google Scholar] 21. Karsai I, Mészáros K, Szűcs P, Hayes PM, Láng L, Bedő Z. Влияние фотопериода на локус Vrn-h3 (4H), который является основным определяющим фактором развития растений и признаков репродуктивной пригодности в факультативном × озимом ячмене ( Hordeum vulgare L.) отображение населения. Селекция растений. 2006 г. Октябрь 1; 125 (5): 468–72. 10.1111 / j.1439-0523.2006.01266.x [CrossRef] [Google Scholar] 22. Cane K, Eagles HA, Laurie DA, Trevaskis B, Vallance N, Eastwood RF, et al. Ppd-B1 и Ppd-D1 и их влияние на пшеницу южной Австралии. Земледелие и пастбищное дело. 2013. июнь 11; 64 (2): 100–14. 10.1071 / CP13086 [CrossRef] [Google Scholar] 23. Miralles DJ, Ричардс РА. Ответы прорастания листьев и побегов и зарождения зачатков пшеницы и ячменя на смену фотопериода.Летопись ботаники. 2000 г. Может 1; 85 (5): 655–63. 10.1006 / anbo.2000.1121 [CrossRef] [Google Scholar] 24. Dyck JA, Matus-Cadiz MA, Hucl P, Talbert L, Hunt T., Dubuc JP, et al. Агрономические показатели изолинов твердой красной яровой пшеницы, чувствительных и нечувствительных к фотопериоду. Наука о растениеводстве. 2004 г. Ноябрь 1; 44 (6): 1976–81. 10.2135 / cropci2004.1976 [CrossRef] [Google Scholar] 25. Икбал М., Наваби А., Янг Р.С., Лосось Д.Ф., Спанер Д. Влияние генов яровизации на раннеспелость и связанные с ней агрономические характеристики яровой пшеницы в северных регионах выращивания.Земледелие. 2007 г. Может 1; 47 (3): 1031–9. 10.2135 / Croccci2006.09.0618 [CrossRef] [Google Scholar] 26. Камран А., Рандхава Х.С., Позняк С., Спанер Д. Фенотипические эффекты комплекса цветущих генов в зародышевой плазме канадской яровой пшеницы. Наука о растениеводстве. 2013. Январь 1; 53 (1): 84–94. 10.2135 / cropci2012.05.0313 [CrossRef] [Google Scholar] 27. Чен Х., Моахар Н.П., Икбал М., Позняк С., Хукл П., Спанер Д. Генетическая изменчивость в отношении времени цветения и генов, снижающих высоту, и важных признаков у яровой пшеницы Западной Канады.Euphytica. 2016 г. Март 1; 208 (2): 377–90. 10.1007 / s10681-015-1615-9 [CrossRef] [Google Scholar] 28. Щербань А.Б., Бёрнер А., Салина Е.А. Влияние генов VRN ‐ 1 и PPD ‐ D1 на время колошения европейских сортов мягкой пшеницы. Селекция растений. 2015 г. Февраль 1; 134 (1): 49–55. 10.1111 / pbr.12223 [CrossRef] [Google Scholar] 29. Гроган С.М., Браун-Гедира Дж., Хейли С.Д., Макмастер Г.С., Рид С.Д., Смит Дж. И др. Аллельные вариации генов развития и влияние на срок колошения озимой пшеницы на Великих равнинах США. ПлоС один.2016 г. апрель 8; 11 (4): e0152852 10.1371 / journal.pone.0152852 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 30. Задокс JC, Чанг TT, Konzak CF. Десятичный код стадии роста злаков. Исследование сорняков. 1974 г. Декабрь 1; 14 (6): 415–21. 10.1111 / j.1365-3180.1974.tb01084.x [CrossRef] [Google Scholar] 31. Procunier JD, Xu J, Kasha KJ. Быстрый и надежный метод выделения ДНК из высших растений. Информационный бюллетень по генетике ячменя. 1990; 20: 74–5. [Google Scholar] 32. ван Берлоо Р. GGT 2.0: универсальное программное обеспечение для визуализации и анализа генетических данных.Журнал наследственности. 2008 г. Январь 24; 99 (2): 232–6. 10.1093 / jhered / esm109 [PubMed] [CrossRef] [Google Scholar] 33. Кумар С., Стечер Г., Тамура К. MEGA7: молекулярно-эволюционный генетический анализ версии 7.0 для больших наборов данных. Молекулярная биология и эволюция. 2016 г. Март 22; 33 (7): 1870–4. 10.1093 / molbev / msw054 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 34. Макмастер GS, Smika DE. Оценка и оценка фенологии озимой пшеницы в центральной части Великих равнин. Сельскохозяйственная и лесная метеорология.1988 г. июнь 1; 43 (1): 1–8. 10.1016 / 0168-1923 (88)
-0 [CrossRef] [Google Scholar] 35. Шапиро СС, Вилк МБ. Анализ дисперсии теста на нормальность (полные выборки). Биометрика. 1965 г. Декабрь 1; 52 (3/4): 591–611. [Google Scholar] 36. Lilliefors HW. О тесте Колмогорова-Смирнова на нормальность с неизвестным средним и дисперсией. Журнал Американской статистической ассоциации. 1967 г. июнь 1; 62 (318): 399–402. 10.1080 / 01621459.1967.10482916 [CrossRef] [Google Scholar] 37. Дорогой Д.А. Тесты Колмогорова-Смирнова, Крамера-фон Мизеса.Летопись математической статистики. 1957 г. Декабрь 1; 28 (4): 823–38. [Google Scholar] 38. Андерсон Т.В., Дорогой Д.А. Асимптотическая теория некоторых критериев согласия, основанная на случайных процессах. Летопись математической статистики. 1952 г. июнь 1: 193–212. [Google Scholar] 39. Андерсон Т.В., Дорогой Д.А. Тест на соответствие. Журнал американской статистической ассоциации. 1954 г. Декабрь 1; 49 (268): 765–9. [Google Scholar] 40. Guo Z, Song Y, Zhou R, Ren Z, Jia J. Открытие, оценка и распределение гаплотипов гена Ppd-D1 пшеницы.Новый фитолог. 2010 г. Февраль 1; 185 (3): 841–51. 10.1111 / j.1469-8137.2009.03099.x [PubMed] [CrossRef] [Google Scholar] 41. Ян Ф.П., Чжан XK, Ся XC, Лори Д.А., Ян В.X., Хэ Чж. Распределение нечувствительного к фотопериоду аллеля Ppd-D1a у китайских сортов пшеницы. Euphytica. 2009 г. Февраль 1; 165 (3): 445–52. 10.1007 / s10681-008-9745-y [CrossRef] [Google Scholar] 43. Zhang X, Gao M, Wang S, Chen F, Cui D. Аллельные вариации в локусах яровизации и фотопериодной чувствительности у китайских сортов озимой пшеницы (Triticum aestivum L.). Границы растениеводства. 2015 г. июль 1; 6: 470 10.3389 / fpls.2015.00470 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 44. Накамичи Н. Адаптация к местной среде путем модификации реакции светового дня сельскохозяйственных культур. Физиология растений и клеток. 2014 г. Ноябрь 27; 56 (4): 594–604. 10.1093 / pcp / pcu181 10.1093 / pcp / pcu181 [Бесплатная статья PMC] [PubMed] [CrossRef] [CrossRef] [Google Scholar] 45. Worland AJ. Влияние генов времени цветения на экологическую адаптивность европейской пшеницы.Euphytica. 1996 г. Январь 1; 89 (1): 49–57. 10.1007 / BF00015718 [CrossRef] [Google Scholar] 46. Дэвидсон Дж. Л., Кристиан К. Р., Джонс Д. Б., Бремнер П. М.. Реакция пшеницы на яровизацию и фотопериод. Австралийский журнал сельскохозяйственных исследований. 1985; 36 (3): 347–59. 10.1071 / AR9850347 [CrossRef] [Google Scholar] 47. Corbesier L, Vincent C, Jang S, Fornara F, Fan Q, Searle I и др. Движение белка FT способствует передаче сигналов на большие расстояния при индукции цветков Arabidopsis. Наука. 2007 г. Может 18; 316 (5827): 1030–3.10.1126 / science.1141752 [PubMed] [CrossRef] [Google Scholar] 48. Ян Л., Фу Д., Ли С., Блехл А., Транквилли Дж., Бонафеде М. и др. Ген яровизации пшеницы и ячменя VRN3 является ортологом FT. Труды Национальной академии наук. 2006 г. Декабрь 19; 103 (51): 19581–6. 10.1073 / pnas.0607142103 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 49. Фоулкс MJ, Сильвестр-Брэдли R, Уорленд AJ, Снейп JW. Влияние гена реакции фотопериода Ppd-D1 на потенциал урожайности и засухоустойчивость озимой пшеницы в Великобритании.Euphytica. 2004 г. Январь 1; 135 (1): 63–73. 10.1023 / B: EUPH.0000009542.06773.13 [CrossRef] [Google Scholar]

, когда он достигнет пика в Великобритании, и даты полнолуния в 2021 году

Июнь: Клубничная луна

Это полнолуние названо в честь начала сезона сбора клубники. Он также известен как «Розовая луна» или «Горячая луна» в ознаменование начала теплой погоды.

Он появляется в том же месяце, что и летнее солнцестояние, самый длинный день в году (21 июня), когда мы можем наслаждаться 16 часами и 38 минутами дневного света.

Когда? 24 июня

Июль: Громовая Луна

Назван в связи с распространением летних гроз. Это иначе известно как полная луна оленя, потому что в это время года рога оленя полностью выросли.

В 2019 году Громовая Луна была особенной, потому что она не только совпала с частичным лунным затмением, но и пришлась на 50-ю годовщину миссии Аполлона-11.

Когда? 24 июля

Август: Осетровая луна

Синоним последних дней лета и начала сбора урожая, Осетровая Луна названа в честь доисторической рыбы, которую коренные американцы ловили в это время года.

Его также часто называют зеленой кукурузной луной, зернистой луной и красной луной из-за красноватого оттенка, который она часто приобретает в летней дымке.

Когда? 22 августа

Сентябрь: Урожайная Луна

Сентябрьское полнолуние ближе всего к осеннему равноденствию. Его называют «Урожайной луной», потому что именно в этом месяце большая часть урожая была собрана перед осенью, когда луна освещала фермеров, чтобы они могли работать дольше вечером.

Некоторые племена также называли это Луной Ячменя, Полной Кукурузной Луной или Фруктовой Луной.

Когда? 21 сентября

Октябрь: Луна Охотника

Октябрьское полнолуние названо так, потому что оно означает идеальное время для охоты на дичь, которая толстеет от поедания падающего зерна, как люди планировали на холодные месяцы вперед.

Десятое полнолуние 2021 года, также известное как Луна путешествия и Луна умирающей травы.

Когда? 20 октября

Кровавая суперлуния

Кровавая суперлуна - это лунное затмение, которое происходит во время полнолуния.В этом году он казался больше и ярче, и в течение нескольких минут в тот же вечер, что и Цветочная Луна, казался красным.

Затмение происходит, когда Земля закрывает Луну от Солнца. Однако для кровавой луны спутник лишь ненадолго скрывается от Солнца тенью Земли, а это означает, что свет фильтруется через атмосферу Земли, позволяя только длинным волнам, красным и оранжевым, проходить и отражаться от поверхности Луны обратно. на Землю.

К сожалению, это явление видно только из определенных частей мира, при этом НАСА утверждает, что те, что на Гавайях, имеют лучший вид.

Для тех, кто жил в Великобритании, было невозможно увидеть в небе Суперцветок Кровавой Луны. Однако на YouTube было несколько прямых трансляций, транслирующих мероприятие с 9:45 по Гринвичу.

Полное лунное затмение

Полное лунное затмение, также известное как «кровавая луна», происходит, когда Луна движется в тень Земли. На расстоянии Луны эта тень выглядит как бычий глаз в центре мишени.

Темная тень медленно ползет по диску Луны, пока не поглотит его полностью.Вы могли подумать, что Луна исчезнет из поля зрения в этот момент, но обычно это не так. Атмосфера Земли действует как линза, преломляя или изгибая красный свет Солнца, чтобы заполнить темную тень. Это приводит к тому, что обычный ярко-белый оттенок Луны превращается в темно-красный апельсин.

Поклонники космоса помнят, что последнее полное лунное затмение украсило наше небо 21 января 2019 года. В общей сложности небесное зрелище - которое также было полнолунием и суперлуной - длилось пять часов 11 минут и 33 секунды с максимальной полнотой. пик в 5:12 утра.

Воздушные опрыскиватели с высокоскоростной технологией заполнения бункеров

Пол Ходжинс уже вел неплохой бизнес в качестве воздушного аппликатора, отвечая на звонки химических компаний и выполняя испытания на пробных площадках, а также применяя фунгициды для фермеров. Между тем, также поступало больше запросов на воздушные посевы покровных культур, наряду с некоторыми просьбами о воздушном посеве озимых зерновых культур.

Теперь, когда низкие цены на сырьевые товары вызывают больший интерес к улучшениям здоровья почвы, таким как покровные культуры, Ходгинс задает больше вопросов о более широком спектре вариантов покровных культур, включая различные смеси.Один клиент недалеко от Ганновера, Онтарио, например, поручил ему посеять покровную культуру овса и райграса для борьбы с эрозией в 2014 году, а затем в 2015 году попросил Ходжинса засеять 400 акров озимой пшеницы по цене от 180 до 200 фунтов на акр.

Именно тогда Ходжинс понял, что ему нужна помощь, и что он должен купить передовую систему загрузки, изготовленную на заказ для воздушных аппликаторов. Ходжинс, президент компании General Airspray Ltd. из Лукана, Онтарио, обнаружил подержанный погрузчик, произведенный компанией Auger Dan, LLC, расположенной в Трумэне, штат Арканзас.

Hodgins впечатлен тем, как его называют «7.5», и особенно его способностью загружать до 7500 фунтов продукта. (Компания также производит загрузочные устройства «10К», конвейерные тележки и смесительные баки.)

Полностью автономный агрегат 7,5 с главным валом отбора мощности грузовика, регулируемой высотой подачи материала, складной трубкой шнека (для транспортировки по дорогам / шоссе) и цифровыми весами, среди прочего.

Ходжинс видел и слышал о различных единицах в прошлые годы либо из торговых журналов, либо во время пребывания в США.С. на съездах опрыскивателей. Затем, увеличив площадь посевных площадей, он перешел на электронную технологию, увеличив поиск в Интернете и на YouTube.

Сейчас Ходгинс задает больше вопросов о покровных культурах, разнообразных смесях и междурядном посеве в стоячие культуры. фото: Пол Ходжинс

«Это всегда была другая система по сравнению с нашим устройством для загрузки жидкости, и всегда наибольшую озабоченность вызывала скорость загрузки и возврата самолета в воздух», - говорит Ходжинс. «В прошлом году мы обработали пару сотен акров земли в Ганновере, и фермер использовал большой шнековый самосвал, но шнек находился сзади, поэтому нам пришлось бы выключить его, заставить его снова подняться и переместить шнек через бункер.Так что мы, вероятно, пробыли на земле больше 10 или 12 минут ».

Быстро и просто

С новым погрузчиком Ходжинсу требуется примерно две или три минуты, чтобы загрузить самолет, в зависимости от нагрузки. Это означает, что самолет может снова подняться в воздух менее чем за половину времени работы шнека с задней загрузкой, что имеет большое значение на больших площадях, особенно в дни, когда цель состоит в том, чтобы получить как можно больше посадок в течение утра. прежде, чем скорость ветра увеличится.

Раньше загрузка любого сухого материала, такого как однолетний райграс для проекта Ассоциации по улучшению почв и посевов Мидлсекса, обычно означала подъем 50-фунтовых мешков с семенами.

«С озимым ячменем, который мы посеяли в прошлом сезоне, у нас не было проблем», - говорит Ходжинс, добавляя, что некоторые производители могли выехать со своими крупными мешками и оттуда заправить погрузчик. «Озимая пшеница, которую мы засеяли в Ганновере в этом году для того же производителя, у них была собственная насыпная пшеница, и они обрабатывали ее, когда загружали ее в наш грузовик, а оттуда ее загружали в самолет».

За два дня, работая с двумя самолетами, Ходгинс и его команда высеяли по воздуху 78 336 фунтов озимой пшеницы для этого фермера, загрузив 1800 фунтов за две-три минуты с помощью 7.5-шнековый самосвал.

Погрузчик, приобретенный General Airspray, позволяет Полу Ходжинсу загружать сухие материалы и возвращаться в воздух за считанные минуты. фото: Пол Ходжинс

Прошлой осенью Ходжинс также засеял кукурузу дополнительно 17 000 фунтов райграса, а в начале октября прошлого года он вылетел 3 500 фунтов озимого ячменя на соевое поле около Эмбро, которое было засеяно 13 июля.

«При наземной погрузке потребовалось бы вдвое больше времени», - говорит Ходжинс, имея в виду операцию по посеву возле Ганновера.«В то первое утро, когда мы установили грузовик фермера и погрузочную систему с обработкой, мы продолжили путь примерно до 9:00, а затем мы летели примерно до 1:00».

На следующий день они начали в 8:00 и закончили к полудню. Без нового погрузчика они вернулись бы на третий день, без вопросов, - говорит Ходжинс. Лучше всего то, что погрузчик может обрабатывать любой сухой материал, будь то семена или удобрения. Конструкция из нержавеющей стали упрощает очистку и устраняет любые опасения по поводу долговременной ржавчины.

«Прошлый год (2015) также был первым годом, когда в начале июля в кукурузу было внесено немного удобрений, чтобы восполнить часть потерь азота из-за дождя в июне», - вспоминает Ходжинс. «Мы использовали грузовик на тендере на удобрения, так что это был такой же медленный процесс, когда нам приходилось резервировать. Таким образом, нам потребовался вечер и утро, чтобы обработать около 300 акров земли, тогда как с помощью этой новой системы мы, вероятно, могли бы сделать все сразу ».

Шнековая тележка также помогает защитить травяные подъездные пути. Несколько лет назад, когда фермер пытался загрузить свой самолет недалеко от Эксетера, грузовик фермера с сыпучими семенами действительно порезал полосу.С его нынешней конфигурацией фермер может оставаться на близлежащих тротуарах или гравийных дорогах, заправлять погрузчик Ходжинса несколькими тысячами фунтов семян и избегать любого повреждения взлетно-посадочной полосы.

«Таким образом, если у фермера есть своя травяная полоса или мы просто едем на травяную полосу или в главный аэропорт, мы можем просто подъехать прямо к участку», - говорит он. «Его легче транспортировать, и на устройстве есть датчики веса, поэтому мы точно знаем, сколько мы вкладываем в самолет. Нормы внесения и сроки по-прежнему являются проблемой для некоторых производителей, но покровные культуры, похоже, станут следующей волной.”

В перспективе

В ожидании вегетационного периода 2016 года Ходжинс хочет подготовиться к дополнительным запросам о покровных культурах, в том числе о посеве в кукурузу, которая является еще одним растущим рынком. Один производитель, у которого Ходжинс посеял озимую пшеницу, попробовал провести промежуточный посев райграса в кукурузу в конце сентября прошлого года. По общему мнению, это оказался хороший улов, отчасти благодаря открытой осени 2015 года.

Другой проблемой для Ходжинса является адаптация его понимания работы с различными сухими материалами.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *