Опята очистка: Как быстро почистить опята разных видов

Содержание

Нужно ли чистить опята под шляпкой. Как сохранить грибы до переработки? Как приготовить засоленные опята

Кира Столетова

Одной из популярных разновидностей грибов являются Опята – они сохраняют своеобразный вкус в жареном, маринованном и в засоленном виде. Правильная предварительная обработка Опят – важный этап, обязательный перед приготовлением, ведь на грибах скапливаются куски земли, травинки и листья.

Первичная обработка в лесу

Чтобы облегчить последующие этапы очистки, стоит начинать процесс прямо во время сбора. Это потребует временных затрат, но зато будет меньше работы дома. Следует отсеять из лукошка червивые и поврежденные экземпляры. С нижней части ножки удаляют острым ножом грязь, землю, хвою и налипшие веточки, обрезаю низ. Обязательно срезают ту часть, которая испорчена молью. Волнистый воротник на ножке убирать необязательно – на вкусовых качествах приготовленного блюда это не отражается. То же касается и юбочки, прозрачной пленки под ножкой.

грибница аккуратно срезается с нижней половины ножки. Со шляпки удаляется пленка.Если гриб срезать, а не сорвать, то не придется удалять грязь и остатки корневища с основания грибов. Наиболее вкусная часть – шляпки, поэтому от ножки можно избавиться и не обрабатывать самую грязную часть гриба.

Техника домашней чистки

Сразу после прогулки по лесу собранный урожай сортируют. Свежие Опята, оторванные от грибницы, начинают быстро темнеть. Обработку откладывать нельзя более, чем на 3 часа после сбора, т.к. грибы очень быстро портятся. В пакете их оставлять не стоит. Правильно чистить Опята сразу по приходу из леса. Если по каким-либо причинам своевременная очистка невозможна, урожай опускают в прохладную воду с добавлением ложки лимонной кислоты и таким же количеством поваренной соли.

Чтобы правильно чистить Опята, понадобится острый ножик, дуршлаг и губка. Последняя нужна для протирания ножки и шляпки. С нижней части ножиком срезается грязь, в некоторых случаях срезается весь низ.

Перед тем, как почистить, ножки отделяют от шляпок.

Все повреждённые места ликвидируются. Ободок под шляпой удаляется или смывается струей воды. После все грибы тщательно промываются (если не сушить их). Молодые опята чистить не требуется.

Последующие действия будут варьироваться, это зависит от способа приготовления. Очистка потребует наличие заточенного компактного ножа, щетку для зубов с жесткой щетиной и кусок мягкой ткани.

  1. Опята для сушки. В этом случае контакт грибов с водой исключается – впитанная влага не испарится из них полностью, поэтому качественного просушивания не состоится. При помощи щетки тщательно прочесываются пластины под шляпой – там могут сидеть жучки. Мягкой тканью счищаются остатки песка.
  2. Для маринования. Потребуется предварительное вымачивание в жидкости на протяжении 40 минут (только нельзя держать более одного часа – тогда опята потеряют часть своих вкусовых качеств). Экземпляры для такого способа обработки подбирают здоровые и крупные.
    Юбочку убирают. Затем продукты промывают под холодной струей не более 3-5 минут. Недавно выросшие опята нуждаются перед мытьем в получасовом вымачивании в воде с солью. Следующий этап – варка в подсоленной воде около 40 минут. После всех процедур разрешено приступать к обработке.
  3. Для заморозки. Такой способ обработки требует свежесобранных экземпляров. Грибы на заморозку отбираются тщательно, повреждения недопустимы. Жесткой щеткой гриб очищается от пылинок, веток и т.д. Маленькие опята не нуждаются в резке на мелкие кусочки. В воде грибы не промывают.

Техника мытья опят

Сразу после того, как грибник закончил обрабатывать плоды, он моет их под прохладной проточной водой, используя дуршлаг. Чтобы промыть опята и избавится от юбочки, напор увеличивают.

Не следует оставлять промытые свежие грибы на ночь. Если после сбора нет времени сразу приступать к готовке, урожай заливают кипяченой водой на 20 минут, раскладывают его вдоль дуршлага, обливают прохладной водой и выкладывают в холодильник. Подобная термическая процедура обеспечивает сохранность Опят и гарантирует их долгое хранение.

Вымачивание опят

Вымачивание производится после предварительной обработки в лесу и перед обрезанием низа ножек и промыванием под водой. Цель вымачивания – окончательное избавление от червяков. Понадобится 1 ч.л. соли на 1 л воды (в качестве профилактики – половина ложки). Соль должна полностью раствориться в жидкости. После того, как грибы будут залиты раствором, червяки всплывут на поверхность. От размера грибов зависит время вымачивания и форма обработки:

  • засолка: вымачивание в крутом соляном растворе в течение 2-х часов;
  • варка: процедура необязательна, основное внимание уделяется чистке и мытью грибов;
  • маринование: урожай замачивают на 30 мин или обдают кипятком, сразу после чего его надо обработать;
  • жарка: вымачивание не требуется;
  • сушка: контакт с водой противопоказан.

Заключение

Обработка Опят после сбора состоит из нескольких этапов, техника исполнения которых зависит от способа приготовления. Следуя инструкции, грибник способен очистить урожай от сора без повреждений. Качественная обработка позволит приготовить вкусное лакомство из собранных Опят.

Каждый грибник радуется, видя в лесу полянку опят, хорошеньких, желтоватых, маленьких… Опята — очень удобные в плане приготовления грибы, их можно и мариновать, и солить, и жарить, конечно, варить из них суп, делать грибные паштеты… Целую массу всего! Но перед тем, как готовить, конечно, нужно «привести их в порядок» — обязательно почистить и помыть, чтобы не оставалось прилипшей листвы или травинок, земли и другой грязи, которая явно не придаст приятного вкусу нашим блюдам. Почему с правильной чисткой опят иногда могут возникнуть трудности? Они небольшого размера, вот и весь их секрет.

Предварительная чистка грибов в лесу

Перед тем, как принести собранные опята домой и начать обработку и приготовление их, нужно пройти подготовительный этап — очистить их в лесу, на той же полянке, где и собрали. Это, конечно, увеличивает время сбора грибов, но оно того стоит — дома вам не нужно будет заниматься такой «чёрной работой», расстелив на полу газеты и расставив по дому вёдра и тазики, в лесу для этого гораздо больше места. Итак, что нужно сделать?

Опята растут большими семействами

Внимательно перебрать грибы, убрать из корзинки сильно поломанные, старые или червивые (если гриб аккуратно выглядит снаружи, но нам показался подозрительным, разламываем шляпку пополам, проверяем наличие червячков). Острым грибным ножом, которым мы пользовались, когда срезали грибные ножки, удаляем с грибов остатки земли и песка (обычно они — на нижней части ножек, которую можно обрезать), а также налипшие листья, сухие хвойные иголки, маленькие веточки и другой не нужный нам мусор. Обрезаем изъеденные насекомыми части грибных ножек и шляпок и обязательно выкидываем их (некоторые грибники пренебрегают этим, хотя это важный шаг).

Нужно убрать со шляпок опят налипшие травинки и листики

Иногда возникает вопрос — что же делать с волнистым воротничком на ножке у гриба? Удалять его не обязательно — здесь стоит руководствоваться своими желаниями, на вкус готовых маринованных, сваренных или пожаренных опят его наличие или отсутствие никак не влияет.

Под шляпками у опят находится юбочка — нежная плёнка, которую можно оставить, а можно убрать

Обычно опята растут целыми семействами на пнях и стволах деревьях, на валежнике, и лишь иногда — на земле, поэтому на них не очень много мусора и грязи, поэтому предварительная чистка грибов в лесу не будет занимать много времени.

Если бы мы говорили о других грибах, то нужно было бы удалить и слизистую плёнку на шляпке, но у опят её нет, поэтому их подготовить к домашней обработке гораздо легче.

Известно, что шляпки грибов гораздо мясистее и питательнее, чем их ножки, поэтому, если лесные полянки богаты опятами, вы можете собирать только шляпки грибов, тогда не придётся тратить время на чистку ножек. Также это не повредит грибнице, и на следующий год в этом месте будет столько же грибов или даже больше.

Правила чистки грибов дома

Важно — рассортировать грибы сразу, как только вы принесли их домой, не откладывая «в долгий ящик», так опята, перестав получать питание от грибниц, очень быстро темнеют, что не влияет на их вкус, но вот внешний вид может пострадать, чего особенно важно избежать, если мы хотим солить или мариновать их.

Свежие грибы портятся достаточно быстро, поэтому у нас есть около пяти часов, чтобы разобрать грибы и засолить, подготовить к сушке или замариновать их.

Если мы не можем заняться чисткой грибов сразу, можно опустить их в холодную воду с щепоткой лимонной кислоты и таким же количеством соли, чтобы предотвратить потемнение.

Для начала нам нужно решить, что мы хотим с нашими опятами делать, ведь от этого зависит и способ их дальнейшей обработки.

Для чистки грибов нам могут понадобиться острый небольшой ножичек, сухая зубная щётка с жёсткими щетинками, а также мягкая щёточка или кусочек мягкой ткани.

Ножичек для грибов должен быть небольшим и острым

Если опята для сушки

Опята, предназначенные для засушивания, не должны соприкасаться при чистке с водой (грибы очень сильно впитывают влагу, и качественно высушить их уже не получится — вода не испарится до конца). Помимо предварительной очистки грибов в лесу, необходимо почистить грибы под шляпкой — сухой зубной щёткой «расчесать» пластинки, между ними могут оказаться жучки или другие мелкие насекомые — убираем их ножом. Со шляпок удаляем оставшиеся частички песка, используя мягкую ткань или щёточку.

Если опята предназначены для сушки, не стоит их замачивать и промывать

Для маринования

Опята, которые мы хотим замариновать, должны быть целыми и красивыми, их нужно замочить в тёплой воде, хватит 40–50 минут. Главное, чтобы замачивание длилось не больше часа, если грибы слишком много проводят времени в воде, они теряют свой вкус. После такого замачивания можно убрать юбочку (можно этого и не делать, но в рассоле юбочка опят обычно размокает, а это влияет на внешний вид маринованных грибов), промыть грибы прохладной проточной водой, важно делать это тщательно, но не долго. Если наши опята совсем молодые, мы замачиваем их на 10 минут в слегка солёной воде, а потом промываем или под проточной водой, или в нескольких водах. Промытые опята нужно отварить в подсоленной воде полчаса, а затем уже солить и мариновать.

Перед маринованием нужно промывать опята особенно тщательно

Некоторые грибники утверждают, что юбочка придаёт маринованным опятам чуть кисловатый привкус и этим портит вкус грибов. Большинство же придерживается иной точки зрения — юбочка не влияет на вкус.

Для заморозки

Замораживать нужно только что собранные грибы, не хранившиеся в течение нескольких дней (даже в холодильнике). Подходят для заморозки только «идеальные» экземпляры — целые, без обрезанных червоточин. Опята перед заморозкой ни в коем случае нельзя мыть, им нужна только сухая чистка — губкой или мягкой щёточкой убираем пылинки, соринки, прилипшие листья и веточки. Разрезать опята на части тоже нет необходимости — они и так небольшого размера.

Для заморозки подходят «идеальные» экземпляры

Как правильно мыть грибы

Опята моются после предварительной обработки в дуршлаге, под прохладной проточной водой. Если вы хотите удалить юбочку под шляпкой у опят, используйте более сильный напор.

Как мыть быстро?

Самый обычный способ — под проточной водой с помощью дуршлага — и есть самый быстрый.

Моем опята в дуршлаге

Видео: как правильно помыть и чистить опята?

Можно ли оставить вымытые опята на ночь?

Не стоит рисковать своим здоровьем и оставлять вымытые опята на ночь. Как уже говорилось, готовить грибы нужно сразу, как вы их собрали. Однако есть и другой вариант — залить опята кипятком на 10 минут, выложить в дуршлаг, промыть водой и убрать в холодильник. Грибы не совсем готовы, и из них всё ещё можно готовить — жарить, варить, мариновать. Тем не менее, они прошли тепловую обработку и уже точно не испортятся.

Вымачивание

Вымачивают опята после предварительной обработки в лесу и перед обрезанием нижней части ножек и промыванием очищенных опят водой.

Вымачивают опята для того, чтобы точно избавиться от мелких червячков, которых не видно даже при тщательном рассмотрении гриба. Как вымочить опята правильно? Придерживаемся следующей пропорции: на 1 литр воды мы берём 1 чайную ложку соли крупного помола, размешиваем до полного растворения соли и заливаем раствором грибы. Если наши подозрения подтвердились, и в грибах действительно были червячки — они погибнут и всплывут. Максимальное время замачивания — час (если опята большие, можно их оставить и на 2 часа). Если грибы не очень червивые, можно делать менее крутой раствор соли (по четверти чайной ложки на 1 литр).

Замачивание опят в солёной воде помогает избавиться от маленьких червячков

Видео: как замачивать и чистить опята?

В каких случаях нужно вымачивать опята?
  • Если мы солим опята? Обязательно вымачиваем их около двух часов в крутом соляном растворе.
  • Если мы варим опята? Можно их не вымачивать, но основное внимание уделить чистке и мойке опят.
  • Если мы маринуем опята? Замачивать их не обязательно, но при желании можно, сократив время до тридцати минут. Однако лучше их просто обдать кипятком, а перед этим хорошо промыть.
  • Если мы жарим опята? Можно вымочить, а можно пренебречь этим шагом.
  • Если мы сушим или замораживаем опята? Замачивать их не стоит ни в коем случае. Эти способы приготовления не любят «мокрых» опят.

Чистка опят (пошаговая инструкция)

Для чистки опят нам понадобятся влажная губка, дуршлаг и небольшой острый нож. Итак, приступим!

  1. Если опята достаточно чистые, без лишнего мусора, протираем их влажной губкой — и шляпку, и ножки.

    После обтирания губкой опята становятся почти чистыми

  2. Срезаем ножичком низ ножки, если на нём имеется грязь. Если опята старые, ножку обрезаем ближе к шляпке, примерно на 2/3.

    Можно отделить друг от друга шляпки и ножки

  3. Обрезаем на шляпке и ножке повреждённые места, если они остались после предварительной чистке опят в лесу.

    Обрезаем кусочки опят с червоточинами

  4. Удаляем ободок под шляпкой, если нам этого хочется (можем просто промыть опята под очень сильной струёй воды — нежная пленочка просто смоется).

    Удаляем юбочку под шляпкой у опят

  5. Помещаем грибы в дуршлаг и промываем опята под проточной водой (только в том случае, если мы их не сушим).

Большинство любителей собирать грибы знают, что встреча с опятами – настоящее событие. Ведь благодаря этим плодовым телам время «грибалки» сокращается вдвое, а сам урожай зачастую бывает очень щедрым. Ведь известно, что опята всегда растут целыми семьями, а значит, можно в короткие сроки наполнить свои корзины до верха. Однако данные плодовые тела не могут долго находиться в свежем виде, поэтому придя домой из леса, собранный урожай тут же подлежит обработке.

Нужно ли убирать плёнку у молодых опят?

Многие задаются вопросом, надо ли чистить плёнку у опят? Вопрос кажется вполне закономерным, ведь данный вид грибов имеет совсем небольшие размеры, поэтому было бы очень хлопотно очищать каждую шляпку. Кроме того, опята – чистые грибы, так как довольно редко растут на земле и почве. В связи с этим на них практически отсутствует крупный лесной мусор.

Способы очистки грибов в частности зависят от их возраста и размера. Нужно ли убирать плёнку у опят молодого возраста? В этом нет необходимости, ведь эти плодовые тела довольно нежные и у них нет такой грубой плёнки, как у представителей других видов грибного «царства». Кроме того, плёнка у опят не маслянистая и не скользкая, в отличие от маслят, поэтому не нуждается в удалении. Всё что нужно, так это просто ножом срезать нижнюю часть ножки, а также соскоблить сильно загрязнённые места: землю, налипшую траву, а также листья. Надо сказать, что у опят часто можно встретить под шляпкой на пластинках разных мелких жучков. Но не бойтесь, это совершенно не говорит об испорченности гриба. В таком случае следует также взять нож и соскоблить все подобные участки. Но можно и не использовать нож, а просто вымочить плодовые тела в подсоленной воде.

Так как опята не требуют сложной чистки и удаления плёнки, то будет достаточно 30 мин подержать в воде, а затем промыть под краном. Но запомните: червивые и почерневшие грибы необходимо сразу же выбросить, дабы обезопасить себя и близких от серьёзных отравлений. Однако если у опёнка повреждена только ножка, то можно не выбрасывать его целиком, а удалить только ножку, оставив шляпку.

Нужно ли снимать пленку у взрослых опят?

А что можно сказать о взрослых или переросших опятах – нужно ли удалять плёнку у них? Если у вас небольшой урожай крупных грибочков, то можно взять сухую губку и протереть шляпки. Однако это делается для того, чтобы удалить грязь и налипший мусор, если таковые имеются. Стоит сказать, что даже у взрослых особей отсутствует твёрдая плёнка на шляпках, поэтому нет необходимости удалять её. Эта шкурка очень тонкая и нежная, поэтому она не придаёт блюду горечи. При отсутствии сильных загрязнений плодовые тела достаточно просто перебрать и промыть в воде в течение нескольких минут. В крайнем случае, их замачивают в миске на 40-50 мин.

Итак, нужно ли снимать плёнку у опят? Как видно, ни маленькие грибочки, ни их зрелые собратья в этом не нуждаются. Наличие плёнки на шляпке опёнка никак не повлияет на вкус и аромат блюда, которое вы хотите приготовить.

Любителей тихой охоты, особенно начинающих, интересует вопрос: что делать с опятами после сбора, как их правильно собирать, перерабатывать, что вкусного приготовить из грибов и если их много, как сохранить продукт до следующего сезона. Простые советы помогут сполна насладиться результатом активного отдыха и вкусно накормить семейство.

Опята – где растут и когда собирать?

Новичков, которые впервые оказались в лесу, одолевает чувство растерянности, с которым гораздо легче справиться, владея базовой информацией о грибах. Зная, как собирать опята, удастся сэкономить время при их переработке, и избавить себя от необходимости лишний раз перебирать грибную массу и срезать лишнее.

  1. Опята сполна оправдывают свое название и растут на старых пнях или очень редко на старых деревьях или у их основания.
  2. Данный грибной вид распространен в лиственных лесах и практически не встречается в хвойных.
  3. При сборе грибов предпочтение следует отдавать некрупным молодым экземплярам, срезая их вместе с ножками, немного выше от грибницы.
  4. У крупных грибов-переростков вкусны только шляпки, а ножки жесткие и немного резиновые на вкус.

Как правильно чистить опята?


Набрав полные лукошки щедрых даров леса, и добравшись с ощущением приятной усталости до дома, останется только переработать грибное изобилие. Всегда хочется это сделать с минимальными трудозатратами и знания, как чистить опята быстро помогут справиться с задачей в лучшем виде.

  1. Если грибы были собраны правильно, много времени чистка не займет. Останется только перебрать грибную массу, удалив при наличии порченые или червивые экземпляры.
  2. Собирая опята второпях, зачастую остаются на ножках части грибницы, которые нужно срезать.
  3. Определенные виды опят имеют чешуйки на шляпках, которые желательно поскоблить ножом или обтереть салфетками.
  4. Как правило, опята не требуют особого подхода при чистке, и их переработка в большинстве своем будет зависеть от дальнейшего предназначения. Например, для заморозки отбирают самые чистые опята без песка и мусора и по возможности их не моют, а просто вытирают бумажным полотенцем. Грибную массу с частичками земли и другими загрязнениями лучше сполоснуть в воде и дать стечь.

Как варить свежие опята?


Переработать опята предпочтительно в первые сутки после сбора. Хранить их в свежем виде допускается не более двух дней. Перед засолкой, маринованием или добавлением в блюда лесные грибы предварительно отваривают.

  1. Перебирают и промывают грибную массу, оставляют в дуршлаге для стекания.
  2. Кипятят воду, добавив в нее столовую ложку соли на два литра жидкости.
  3. Закладывают подготовленные грибы, дают содержимому кастрюли повторно закипеть, снимая пену.
  4. Сколько времени варить опята зависит от размера и степени зрелости грибов. Признаком готовности будет опускание грибной массы на дно. Как правило, варка занимает около получаса.

Что можно сделать с опятами?


Разобравшись, что делать с опятами после сбора, и правильно их подготовив к дальнейшему приготовлению, можно приступать к исполнению рецептов для получения вкусных закусок или самостоятельных блюд. Популярные версии применения опят в кулинарии или заготовки их впрок помогут использовать продукт максимально результативно.

  1. Рецепты с опятами могут предполагать их варку с последующим тушением, жаркой, а также заготовку впрок в виде маринованной закуски или икры.
  2. Многокомпонентные блюда с опятами, где грибы сочетаются с овощами или мясом, порадуют великолепными вкусовыми и питательными характеристиками, потрясающим насыщенным ароматом.
  3. Рецепты с опятами на зиму включают длительную стерилизацию заготовок, которые впоследствии можно герметично укупоривать. Без стерилизации сосуды можно хранить в холоде под неплотно прикрытыми крышками.

Как мариновать опята на зиму с уксусом?


С уксусом позволит сохранить любимые грибы до следующего сезона и обеспечить семейство вкуснейшей закуской. Набор пряностей допускается составлять исходя из индивидуальных пристрастий, добавляя новые пикантные компоненты по вкусу или заменяя ими предложенные.

Ингредиенты:

  • опята – 1,5 кг;
  • вода – 3 стакана;
  • сахарный песок – 4 ч. ложки;
  • соль – 2 ст. ложки;
  • уксус – 1/3 стакана;
  • лавр, душистый перец, гвоздика, чеснок, растительное масло.

Приготовление

  1. Опята отваривают 20 минут, промывают, дают стечь.
  2. Кипятят воду с добавлением соли, сахара, специй и пряностей.
  3. Вливают уксус, закладывают грибы и варят 30 минут.
  4. Раскладывают грибную массу с маринадом в банки, стерилизуют их 20 минут, укупоривают, тепло укутывают до остывания.

Как сушить опята?


Великолепной зимней заготовкой станут . Их можно применять для варки первых блюд, добавлять в салаты, другие кулинарные композиции. Нужно просто замочить продукт на несколько часов, после чего отварить до полной готовности в течение 30 минут.

  1. Перед сушкой опята не желательно мыть, а только обтереть салфетками или бумажными полотенцами.
  2. Грибы можно нанизать на нитки и высушить при хорошей погоде в естественных условиях на чердаке или под навесом.
  3. Подобные связки сушат и в сухих проветриваемых теплых помещениях.
  4. Более современный способ сушки опят – применение электросушилки. Грибные экземпляры раскладывают на поддонах и сушат при температуре 50 градусов до выпаривания влаги.
  5. Высушить грибы можно в духовке: опята раскладывают на противне и помещают в разогретое до 60 градусов устройство на 4-7 часов. Дверца при этом должна быть немного приоткрыта.

Как правильно заморозить опята на зиму?


Изучая, что можно делать с опятами после сбора, многих привлекают рекомендации по заморозке продукта. При наличии свободного места в холодильнике и катастрофической нехватке времени данный способ заготовки является одним из самых приоритетных. О том, как заморозить опята свежие на зиму, в следующих пунктах:

  1. Грибы желательно не мыть, а просто протереть полотенцем или салфетками, а мусор или немногочисленный песок счистить щеткой.
  2. Опята раскладывают одним слоем в камере, подмораживают, после чего ссыпают в пакет для хранения и окончательной заморозки.
  3. Замораживать можно и уже отваренные или обжаренные грибы, разложив их в порционные пакеты или емкости.

Как варить суп из опят?


Которого будет изложен далее, можно сварить исключительно с овощами или добавить в состав крупу, макаронные изделия. Вкусным и питательным горячее будет, если в качестве жидкой составляющей взять мясной бульон, а при подаче в тарелки положить нарезанное некрупными ломтиками отваренное мясо.

Ингредиенты:

  • опята – 0,5 кг;
  • вода или бульон – 2 л;
  • картофель – 4-6 шт.;
  • лук и морковь – по 1 шт.;
  • лавр, горошины перца, соль, зелень – по вкусу;
  • масло – 40 г.

Приготовление

  1. Отваривают опята 20 минут, откидывают на сито, перекладывают в кипящий бульон.
  2. Добавляют картофельные кубики, а через 10 минут варки вводят пассеровку из лука и моркови.
  3. Приправляют горячее по вкусу, варят 10 минут, подают с зеленью и по желанию со сметаной.

Как пожарить опята с луком?


Рецепты с опятами свежими исполняются без предварительного отваривания только при уверенности в качестве грибов и их экологической чистоте. При наличии такого продукта можно пожарить его с добавлением лука и сметаны. Изумительный насыщенный вкус и потрясающий аромат блюда достоин самой высокой похвалы.

Ингредиенты:

  • опята – 800 г;
  • лук – 1 шт.;
  • сметана – 200 г;
  • масло – 70 г;
  • соль, перец, зелень.

Приготовление

  1. Подготовленные грибы закладывают в сковороду, заливают стаканом воды и припускают под крышкой 20 минут.
  2. Открывают крышку, выпаривают влагу.
  3. Добавляют масло, нарезанный лук, обжаривают компоненты до румянца, вмешивают сметану.
  4. Приправляют опята жареные с луком и сметаной по вкусу солью, перцем, зеленью, прогревают минуту и дают немного настояться.

Как пожарить опята с картошкой?


Неизменная классика, которая не теряет популярности с течением времени – . Вкус кулинарной композиции даже без дополнительных приправ и пряных добавок радует неподражаемой гармонией. Зачастую состав дополняют луком, а для пикантности в конце жарки можно добавить мелко нарубленный чеснок.

Ингредиенты:

  • опята – 800 г;
  • лук – 1 шт.;
  • картофель – 1,5 кг;
  • масло – 100 мл.

Приготовление

  1. Отваривают опята до готовности, откидывают на дуршлаг.
  2. Подрумянивают на масле лук, добавляют грибы, выпаривают влагу.
  3. Закладывают очищенный и нарезанный некрупно картофель и жарят составляющие, помешивая.
  4. Картошка с опятами будет готова, когда ломтики овоща станут мягкими.

Салат с жареными опятами


Если есть желание приготовить салат с грибами, курица с опятами – беспроигрышное сочетание. Дополнив компоненты нарезанным или тертым сыром, орехами мелко нарубленным чесноком и заправив майонезом, удастся получить великолепную закуску, которая и в праздничном меню займет не последнее место. По желанию блюдо можно оформить слоями, покрывая каждый майонезной сеткой, после чего оставить на несколько часов для пропитки.

Ингредиенты:

  • опята – 700 г;
  • куриное филе – 0,5 кг;
  • сыр – 200 г;
  • орехи – неполный стакан;
  • чеснок – 2 зубка;
  • соль, перец, майонез, масло.

Приготовление

  1. Отваривают до готовности, а затем обжаривают на масле опята.
  2. Мелко нарезают отваренную курятину, добавляют к грибам.
  3. Туда же отправляют сыр, орехи, чеснок.
  4. Приправляют салат солью, перцем, майонезом, перемешивают, дают настояться.

Паста с опятами


Изысканным блюдом для домашней трапезы по поводу или без станет . Дополнительный пикантный вкус придаст яству сушеный или свежий базилик, щепотка итальянских или прованских трав. Не менее популярна версия с чесноком, который добавляют на завершающем этапе готовки.

Ингредиенты:

  • опята – 0,5 кг;
  • паста – 0,5 кг;
  • куриное филе – 250 г;
  • сыр плавленый и твердый – по 150 г;
  • сливки – 200 мл;
  • лук – 100 г;
  • карри, соль, перец, масло, зелень.

Приготовление

  1. Обжаривают по отдельности нарезанную курятину и предварительно отваренные опята с луком.
  2. Соединяют мясо и грибную поджарку, добавляют сливки, плавленый сыр.
  3. Приправляют соус по вкусу, протушивают 5 минут, вмешивают перетертый твердый сыр и отваренную пасту.
  4. Подают блюдо незамедлительно, разложив по теплым тарелкам и приправив зеленью.

Икра из опят с чесноком – рецепт


Икра из опят с чесноком может быть приготовлена из некондиционных экземпляров, обрезанных ножек или зрелых грибов, которые малопригодны для других блюд и заготовок. Полученная закуска – великолепное дополнение к ломтику свежего хлеба, компонент для создания начинки в выпечку или добавка к другим блюдам.

Ингредиенты:

  • опята – 0,5 кг;
  • морковь – 100 г;
  • лук – 200 г;
  • чеснок – 3 зубка;
  • соль, перец, масло.

Приготовление

  1. Опята отваривают 20 минут, после чего обжаривают на масле с добавлением лука.
  2. Отдельно припускают на масле перетертую морковь.
  3. Соединяют грибы с луком, морковь и чеснок в блендере, измельчают.
  4. Солят икру, перчат, перемешивают, дают немного настояться.

Жульен с опятами – рецепт


Жульен с опятами – блюдо для праздничного меню, которым можно побаловать семейство и в будни. Восхитительный насыщенный вкус лакомства с французскими корнями невозможно испортить, особенно, если выбрать для исполнения рецепта качественный натуральный сыр, домашнюю сметану. При подаче украшают яство зеленью.

Ингредиенты:

  • опята – 1,2 кг;
  • лук – 300 г;
  • сметана – 300 г;
  • сливочный сыр – 200 г;
  • масло – 70 г;
  • мука – 30 г;
  • соль, перец, зелень.

Приготовление

  1. Обжаривают на масле лук, добавляют муку, пассеруют 2 минуты.
  2. Закладывают предварительно отваренные до готовности опята, сметану, перемешивают и прогревают немного.
  3. Раскладывают массу по промасленным кокотницам, посыпают сыром и запекают при 180 градусах 7-10 минут.

Пирог с опятами – рецепт


Следующий рецепт для тех, кто не прочь побаловать себя домашней выпечкой. В качестве начинки в данном случае используются отваренные, а затем обжаренные опята. Грибную массу можно по желанию дополнить спассерованным на масле луком, а вместо песочного теста, приготовленного из указанных ингредиентов, взять готовое слоеное тесто.

Опята – наиболее распространенные из лесных грибов, в том числе и потому что растут группами, а не по одному. Их просто собирать, они представлены в регионах с разным климатом, содержат в себе вещество фламмулин, предотвращающее саркому, большое количество витаминов группы В, витамина Е, РР, аскорбиновой кислоты, в ножках много клетчатки, полезной для пищеварения, поэтому опята очень популярны среди людей и являются ингредиентом многих блюд. Из этих грибов можно готовить супы, вторые блюда, закуски. Подходят они также для маринования и соления. Несмотря на такую большую популярность, вопрос, как грамотно почистить и приготовить опята, очень актуален.

Собирать опята лучше в корзину, так как в мешке они могут быстро отмокнуть, потеряв форму. При сборе нужно обязательно уметь отличать их от ложных грибов: у истинных на верхней части ножки всегда имеется кольцо, или юбочка. Это остаток защищающего плодовое тело молодого гриба покрывала. Ложные грибы могут расти на том же самом пне, что и настоящие, их очень легко спутать. Порой только опытные грибники могут их правильно различить. Ложные опята либо несъедобны, либо вообще ядовиты. Вот почему наиболее безопасными считаются грибы, выращенные промышленно. Ну а для тех, кто ходит за грибным урожаем самостоятельно, должно всегда действовать непреложное правило: не уверен – не собирай.

Чистка грибов: зачем и как?

Собранные свежие опята имеют свойство быстро темнеть, поэтому обработать их надо сразу по принесении домой. Очищенные просушенные грибы могут храниться в морозилке в течение года. Перед тем, как начать обработку, собранный урожай необходимо перебрать. Старые, мятые, гнилые, а также изъеденные червям или насекомыми экземпляры подлежат безжалостному удалению, готовить их нельзя. Если же поражена только ножка, то можно ее выбросить, оставив шляпку. Также нужно убрать прилипший мусор – травинки, листья, веточки.

Часто возникает вопрос, зачем чистить опята, ведь из-за их небольшого размера это очень хлопотно. Дело в том, что даже на пригодных к употреблению грибах могут быть поврежденные места, от которых нужно избавляться. Кроме того, под шляпкой зачастую можно найти маленьких жучков. Это не говорит о порче гриба, их можно легко удалить.

Перед непосредственной обработкой нужно решить, пойдут опята на засушивание или нет. От этого зависит метод очистки. Если их планируется засушить, то будет достаточно срезать ножом поврежденные места. Рекомендуется также отрезать нижнюю половину ножки, даже если она хорошая, так как ножки у опят бывают твердоваты. Далее сухой зубной щеткой с жесткими ворсинками надо убрать пленку под шляпкой. Если наблюдаются насекомые, то их можно легко удалить ножом. При обработке грибов перед засушиванием вода не используется.

Если опята планируется готовить свежими или же они предназначены для маринования, то перед непосредственной очисткой правильно будет их ненадолго замочить в теплой воде. Замачивание не должно длиться более часа – слишком пропитавшиеся влагой грибы теряют вкус. После замачивания нужно ножом соскоблить пленку, или юбочку, промыть грибы водой, чтобы избавиться от насекомых под шляпкой. Если хозяйка ищет способ, как почистить опята быстро, то юбочку можно не убирать, на вкусовые характеристики это не повлияет, а времени на чистку уйдет меньше. Собственно, в этом и состоит весь процесс очистки – лесные грибы не требуют слишком тщательной обработки.

Как варить опята?

Теперь, когда грибы очищены, можно их готовить. Перед варкой нужно позаботиться о наличии эмалированной кастрюли. Посуда должна быть без сколов. Вода в кастрюле доводится до кипения, после чего туда кладутся грибы и варятся 5 минут. Образовывающуюся пену при этом следует снимать. Затем нужно сменить воду, вновь довести ее до кипения, варить грибы уже в течение получаса. Проваренные опята оседают на дно кастрюли, а не остаются на поверхности. После того, как грибы сварены, их нужно выложить в дуршлаг, чтобы дать стечь с них лишней воде, а саму воду надо слить. Теперь можно готовить блюда. Если грибы предназначены для жарки, то их все равно нужно предварительно проваривать. Чтобы подстраховаться от отравления, перед тем, как начать готовить, нужно дополнительно проварить опята в подсоленной воде в течение 10 минут, затем эту воду вылить.

Блюда из свежих опят

Из опят можно приготовить прекрасный грибной суп. Для этого понадобится одна морковь, 1 головка репчатого лука и 4 средних по величине картофелины. Лук следует нашинковать, морковь натереть крупно, а затем все обжарить и бросить в грибной бульон вместе с нарезанной кубиками картошкой. Соль, приправы добавить по вкусу. Варится такой суп примерно 20 минут.

Из вареных грибов можно также сделать салат. Для этого опята нужно порезать, сварить картофель в мундире, приготовить вареное яйцо. Очищенную картошку и яйцо нарезать, добавить порезанный на полудольки помидор, все смешать, добавить соли, перца, заправить маслом. Сверху можно посыпать свежей зеленью.

Засолене опята

Опята вкусны в любом виде – свежие, засоленные, маринованные. Для того, чтобы засолить грибы, нужно шляпки отделить от ножек и порезать все напополам. Если грибы очень маленькие, то можно их не нарезать. Далее нужно очистить и разрезать на половинки чеснок, нашинковать лук полукольцами, порубить укроп. Все ингредиенты плюс лавровый лист со специями добавить к вареным грибам. Далее добавляется соль: на килограмм опят будет достаточно примерно 2-2,5 столовых ложек. Все перемешивается, выкладывается под гнет в емкость на 5 дней. Затем грибы следует переложить в стерильную банку и хранить в холодильнике. Для требуется 20 дней.

Есть более сложный способ соления. При нем специи с грибами выкладывают на дно посудины, посыпаются сверху солью и выдерживаются под гнетом полтора месяца. Гнет нужно периодически промывать, если образуется плесень, то ее следует снимать. Спустя указанное время соленые опята раскладывают по банкам и хранятся в прохладном сухом месте.

Грибы опята как чистить


Опята: как правильно чистить и мыть эти грибочки?

Каждый грибник радуется, видя в лесу полянку опят, хорошеньких, желтоватых, маленьких… Опята — очень удобные в плане приготовления грибы, их можно и мариновать, и солить, и жарить, конечно, варить из них суп, делать грибные паштеты… Целую массу всего! Но перед тем, как готовить, конечно, нужно «привести их в порядок» — обязательно почистить и помыть, чтобы не оставалось прилипшей листвы или травинок, земли и другой грязи, которая явно не придаст приятного вкусу нашим блюдам. Почему с правильной чисткой опят иногда могут возникнуть трудности? Они небольшого размера, вот и весь их секрет.

Предварительная чистка грибов в лесу

Перед тем, как принести собранные опята домой и начать обработку и приготовление их, нужно пройти подготовительный этап — очистить их в лесу, на той же полянке, где и собрали. Это, конечно, увеличивает время сбора грибов, но оно того стоит — дома вам не нужно будет заниматься такой «чёрной работой», расстелив на полу газеты и расставив по дому вёдра и тазики, в лесу для этого гораздо больше места. Итак, что нужно сделать?

Опята растут большими семействами

Внимательно перебрать грибы, убрать из корзинки сильно поломанные, старые или червивые (если гриб аккуратно выглядит снаружи, но нам показался подозрительным, разламываем шляпку пополам, проверяем наличие червячков). Острым грибным ножом, которым мы пользовались, когда срезали грибные ножки, удаляем с грибов остатки земли и песка (обычно они — на нижней части ножек, которую можно обрезать), а также налипшие листья, сухие хвойные иголки, маленькие веточки и другой не нужный нам мусор. Обрезаем изъеденные насекомыми части грибных ножек и шляпок и обязательно выкидываем их (некоторые грибники пренебрегают этим, хотя это важный шаг).

Нужно убрать со шляпок опят налипшие травинки и листики

Иногда возникает вопрос — что же делать с волнистым воротничком на ножке у гриба? Удалять его не обязательно — здесь стоит руководствоваться своими желаниями, на вкус готовых маринованных, сваренных или пожаренных опят его наличие или отсутствие никак не влияет.

Под шляпками у опят находится юбочка — нежная плёнка, которую можно оставить, а можно убрать

Обычно опята растут целыми семействами на пнях и стволах деревьях, на валежнике, и лишь иногда — на земле, поэтому на них не очень много мусора и грязи, поэтому предварительная чистка грибов в лесу не будет занимать много времени.

Если бы мы говорили о других грибах, то нужно было бы удалить и слизистую плёнку на шляпке, но у опят её нет, поэтому их подготовить к домашней обработке гораздо легче.

Известно, что шляпки грибов гораздо мясистее и питательнее, чем их ножки, поэтому, если лесные полянки богаты опятами, вы можете собирать только шляпки грибов, тогда не придётся тратить время на чистку ножек. Также это не повредит грибнице, и на следующий год в этом месте будет столько же грибов или даже больше.

Правила чистки грибов дома

Важно — рассортировать грибы сразу, как только вы принесли их домой, не откладывая «в долгий ящик», так опята, перестав получать питание от грибниц, очень быстро темнеют, что не влияет на их вкус, но вот внешний вид может пострадать, чего особенно важно избежать, если мы хотим солить или мариновать их. Свежие грибы портятся достаточно быстро, поэтому у нас есть около пяти часов, чтобы разобрать грибы и засолить, подготовить к сушке или замариновать их.

Если мы не можем заняться чисткой грибов сразу, можно опустить их в холодную воду с щепоткой лимонной кислоты и таким же количеством соли, чтобы предотвратить потемнение.

Для начала нам нужно решить, что мы хотим с нашими опятами делать, ведь от этого зависит и способ их дальнейшей обработки.

Для чистки грибов нам могут понадобиться острый небольшой ножичек, сухая зубная щётка с жёсткими щетинками, а также мягкая щёточка или кусочек мягкой ткани.

Ножичек для грибов должен быть небольшим и острым

Если опята для сушки

Опята, предназначенные для засушивания, не должны соприкасаться при чистке с водой (грибы очень сильно впитывают влагу, и качественно высушить их уже не получится — вода не испарится до конца). Помимо предварительной очистки грибов в лесу, необходимо почистить грибы под шляпкой — сухой зубной щёткой «расчесать» пластинки, между ними могут оказаться жучки или другие мелкие насекомые — убираем их ножом. Со шляпок удаляем оставшиеся частички песка, используя мягкую ткань или щёточку.

Если опята предназначены для сушки, не стоит их замачивать и промывать

Для маринования

Опята, которые мы хотим замариновать, должны быть целыми и красивыми, их нужно замочить в тёплой воде, хватит 40–50 минут. Главное, чтобы замачивание длилось не больше часа, если грибы слишком много проводят времени в воде, они теряют свой вкус. После такого замачивания можно убрать юбочку (можно этого и не делать, но в рассоле юбочка опят обычно размокает, а это влияет на внешний вид маринованных грибов), промыть грибы прохладной проточной водой, важно делать это тщательно, но не долго. Если наши опята совсем молодые, мы замачиваем их на 10 минут в слегка солёной воде, а потом промываем или под проточной водой, или в нескольких водах. Промытые опята нужно отварить в подсоленной воде полчаса, а затем уже солить и мариновать.

Перед маринованием нужно промывать опята особенно тщательно

Некоторые грибники утверждают, что юбочка придаёт маринованным опятам чуть кисловатый привкус и этим портит вкус грибов. Большинство же придерживается иной точки зрения — юбочка не влияет на вкус.

Для заморозки

Замораживать нужно только что собранные грибы, не хранившиеся в течение нескольких дней (даже в холодильнике). Подходят для заморозки только «идеальные» экземпляры — целые, без обрезанных червоточин. Опята перед заморозкой ни в коем случае нельзя мыть, им нужна только сухая чистка — губкой или мягкой щёточкой убираем пылинки, соринки, прилипшие листья и веточки. Разрезать опята на части тоже нет необходимости — они и так небольшого размера.

Для заморозки подходят «идеальные» экземпляры

Как правильно мыть грибы

Опята моются после предварительной обработки в дуршлаге, под прохладной проточной водой. Если вы хотите удалить юбочку под шляпкой у опят, используйте более сильный напор.

Самый обычный способ — под проточной водой с помощью дуршлага — и есть самый быстрый.

Моем опята в дуршлаге

Видео: как правильно помыть и чистить опята?
Можно ли оставить вымытые опята на ночь?

Не стоит рисковать своим здоровьем и оставлять вымытые опята на ночь. Как уже говорилось, готовить грибы нужно сразу, как вы их собрали. Однако есть и другой вариант — залить опята кипятком на 10 минут, выложить в дуршлаг, промыть водой и убрать в холодильник. Грибы не совсем готовы, и из них всё ещё можно готовить — жарить, варить, мариновать. Тем не менее, они прошли тепловую обработку и уже точно не испортятся.

Вымачивание

Вымачивают опята после предварительной обработки в лесу и перед обрезанием нижней части ножек и промыванием очищенных опят водой.

Вымачивают опята для того, чтобы точно избавиться от мелких червячков, которых не видно даже при тщательном рассмотрении гриба. Как вымочить опята правильно? Придерживаемся следующей пропорции: на 1 литр воды мы берём 1 чайную ложку соли крупного помола, размешиваем до полного растворения соли и заливаем раствором грибы. Если наши подозрения подтвердились, и в грибах действительно были червячки — они погибнут и всплывут. Максимальное время замачивания — час (если опята большие, можно их оставить и на 2 часа). Если грибы не очень червивые, можно делать менее крутой раствор соли (по четверти чайной ложки на 1 литр).

Замачивание опят в солёной воде помогает избавиться от маленьких червячков

Видео: как замачивать и чистить опята?

В каких случаях нужно вымачивать опята?
  • Если мы солим опята? Обязательно вымачиваем их около двух часов в крутом соляном растворе.
  • Если мы варим опята? Можно их не вымачивать, но основное внимание уделить чистке и мойке опят.
  • Если мы маринуем опята? Замачивать их не обязательно, но при желании можно, сократив время до тридцати минут. Однако лучше их просто обдать кипятком, а перед этим хорошо промыть.
  • Если мы жарим опята? Можно вымочить, а можно пренебречь этим шагом.
  • Если мы сушим или замораживаем опята? Замачивать их не стоит ни в коем случае. Эти способы приготовления не любят «мокрых» опят.
Чистка опят: пошаговая инструкция

Для чистки опят нам понадобятся влажная губка, дуршлаг и небольшой острый нож. Итак, приступим!

  1. Если опята достаточно чистые, без лишнего мусора, протираем их влажной губкой — и шляпку, и ножки.

    После обтирания губкой опята становятся почти чистыми

  2. Срезаем ножичком низ ножки, если на нём имеется грязь. Если опята старые, ножку обрезаем ближе к шляпке, примерно на 2/3.

    Можно отделить друг от друга шляпки и ножки

  3. Обрезаем на шляпке и ножке повреждённые места, если они остались после предварительной чистке опят в лесу.

    Обрезаем кусочки опят с червоточинами

  4. Удаляем ободок под шляпкой, если нам этого хочется (можем просто промыть опята под очень сильной струёй воды — нежная пленочка просто смоется).

    Удаляем юбочку под шляпкой у опят

  5. Помещаем грибы в дуршлаг и промываем опята под проточной водой (только в том случае, если мы их не сушим).

    Промываем опята в дуршлаге

  6. Опята почищены!
Видео: как правильно и без хлопот чистить грибочки
Есть ли различия чистки для варки, жарки, маринования?

В подготовке опят нет особых различий для варки, маринования или жарки. Перед варкой или жаркой очищенные опята промывают в воде. Юбочки перед жаркой можно не убирать, так как под воздействием температуры они усыхают, становясь совсем незаметными. Перед варкой можно избавиться от них, если вы варите грибы целиком и оставить, если разрезаете опёнок на части — это просто вопрос внешнего вида. Что касается юбочек опят при мариновании, они имеют неприятное свойство расползаться и портить эстетический вид продукта — так что их лучше убрать.

Перед жаркой у опят можно не убирать юбочки

Нюансы очистки

Под шляпкой между пластинками у опят можно встретить мелких насекомых и жучков, поэтому, если опята не молодые, стоит их почистить. Можно использовать небольшую щётку и аккуратно, чтобы не повредить пластинки, пройтись ей от центра к краям, вычистив ненужную живность. Можно не пользоваться щёткой, но промыть опята под струёй воды, которая вымоет из-под шляпки насекомых, но это не подойдёт для тех грибов, которые вы собираетесь заморозить или засушить.

Не нужно чистить свежие молодые опята, которые не соприкасались с землёй — росли на пнях или на основаниях деревьев, они и без того чистые.

Молодые опята можно не чистить

Влажная губка и ножичек — наши верные друзья в быстрой чистке опят. Если мы не удаляем юбочку, это тоже придаёт нам скорости.

Чистить и мыть опята — совсем не сложное занятие, но требует много времени в том случае, если вы решаете убирать нежную юбочку из-под шляпки у каждого опёнка. Грибы эти приятные в обработке и очень вкусные, главное — их правильная подготовка к засолке, маринованию, жарке или варке. Пользуясь советами, данными в статье, вы подготовите опята должным образом. Готовьте с удовольствием!

Опята — как правильно чистить и мыть эти грибочки? – Stroim24.info

Каждый грибник радуется, видя в лесу полянку опят, хорошеньких, желтоватых, маленьких… Опята — очень удобные в плане приготовления грибы, их можно и мариновать, и солить, и жарить, конечно, варить из них суп, делать грибные паштеты… Целую массу всего! Но перед тем, как готовить, конечно, нужно «привести их в порядок» — обязательно почистить и помыть, чтобы не оставалось прилипшей листвы или травинок, земли и другой грязи, которая явно не придаст приятного вкусу нашим блюдам. Почему с правильной чисткой опят иногда могут возникнуть трудности? Они небольшого размера, вот и весь их секрет.

Предварительная чистка грибов в лесу

Перед тем, как принести собранные опята домой и начать обработку и приготовление их, нужно пройти подготовительный этап — очистить их в лесу, на той же полянке, где и собрали. Это, конечно, увеличивает время сбора грибов, но оно того стоит — дома вам не нужно будет заниматься такой «чёрной работой», расстелив на полу газеты и расставив по дому вёдра и тазики, в лесу для этого гораздо больше места. Итак, что нужно сделать?

Опята растут большими семействами

Внимательно перебрать грибы, убрать из корзинки сильно поломанные, старые или червивые (если гриб аккуратно выглядит снаружи, но нам показался подозрительным, разламываем шляпку пополам, проверяем наличие червячков). Острым грибным ножом, которым мы пользовались, когда срезали грибные ножки, удаляем с грибов остатки земли и песка (обычно они — на нижней части ножек, которую можно обрезать), а также налипшие листья, сухие хвойные иголки, маленькие веточки и другой не нужный нам мусор. Обрезаем изъеденные насекомыми части грибных ножек и шляпок и обязательно выкидываем их (некоторые грибники пренебрегают этим, хотя это важный шаг).

Нужно убрать со шляпок опят налипшие травинки и листики

Иногда возникает вопрос — что же делать с волнистым воротничком на ножке у гриба? Удалять его не обязательно — здесь стоит руководствоваться своими желаниями, на вкус готовых маринованных, сваренных или пожаренных опят его наличие или отсутствие никак не влияет.

Под шляпками у опят находится юбочка — нежная плёнка, которую можно оставить, а можно убрать

Обычно опята растут целыми семействами на пнях и стволах деревьях, на валежнике, и лишь иногда — на земле, поэтому на них не очень много мусора и грязи, поэтому предварительная чистка грибов в лесу не будет занимать много времени.

Если бы мы говорили о других грибах, то нужно было бы удалить и слизистую плёнку на шляпке, но у опят её нет, поэтому их подготовить к домашней обработке гораздо легче.

Известно, что шляпки грибов гораздо мясистее и питательнее, чем их ножки, поэтому, если лесные полянки богаты опятами, вы можете собирать только шляпки грибов, тогда не придётся тратить время на чистку ножек. Также это не повредит грибнице, и на следующий год в этом месте будет столько же грибов или даже больше.

Правила чистки грибов дома

Важно — рассортировать грибы сразу, как только вы принесли их домой, не откладывая «в долгий ящик», так опята, перестав получать питание от грибниц, очень быстро темнеют, что не влияет на их вкус, но вот внешний вид может пострадать, чего особенно важно избежать, если мы хотим солить или мариновать их. Свежие грибы портятся достаточно быстро, поэтому у нас есть около пяти часов, чтобы разобрать грибы и засолить, подготовить к сушке или замариновать их.

Если мы не можем заняться чисткой грибов сразу, можно опустить их в холодную воду с щепоткой лимонной кислоты и таким же количеством соли, чтобы предотвратить потемнение.

Для начала нам нужно решить, что мы хотим с нашими опятами делать, ведь от этого зависит и способ их дальнейшей обработки.

Для чистки грибов нам могут понадобиться острый небольшой ножичек, сухая зубная щётка с жёсткими щетинками, а также мягкая щёточка или кусочек мягкой ткани.

Ножичек для грибов должен быть небольшим и острым

Если опята для сушки

Опята, предназначенные для засушивания, не должны соприкасаться при чистке с водой (грибы очень сильно впитывают влагу, и качественно высушить их уже не получится — вода не испарится до конца). Помимо предварительной очистки грибов в лесу, необходимо почистить грибы под шляпкой — сухой зубной щёткой «расчесать» пластинки, между ними могут оказаться жучки или другие мелкие насекомые — убираем их ножом. Со шляпок удаляем оставшиеся частички песка, используя мягкую ткань или щёточку.

Если опята предназначены для сушки, не стоит их замачивать и промывать

Для маринования

Опята, которые мы хотим замариновать, должны быть целыми и красивыми, их нужно замочить в тёплой воде, хватит 40–50 минут. Главное, чтобы замачивание длилось не больше часа, если грибы слишком много проводят времени в воде, они теряют свой вкус. После такого замачивания можно убрать юбочку (можно этого и не делать, но в рассоле юбочка опят обычно размокает, а это влияет на внешний вид маринованных грибов), промыть грибы прохладной проточной водой, важно делать это тщательно, но не долго. Если наши опята совсем молодые, мы замачиваем их на 10 минут в слегка солёной воде, а потом промываем или под проточной водой, или в нескольких водах. Промытые опята нужно отварить в подсоленной воде полчаса, а затем уже солить и мариновать.

Перед маринованием нужно промывать опята особенно тщательно

Некоторые грибники утверждают, что юбочка придаёт маринованным опятам чуть кисловатый привкус и этим портит вкус грибов. Большинство же придерживается иной точки зрения — юбочка не влияет на вкус.

Для заморозки

Замораживать нужно только что собранные грибы, не хранившиеся в течение нескольких дней (даже в холодильнике). Подходят для заморозки только «идеальные» экземпляры — целые, без обрезанных червоточин. Опята перед заморозкой ни в коем случае нельзя мыть, им нужна только сухая чистка — губкой или мягкой щёточкой убираем пылинки, соринки, прилипшие листья и веточки. Разрезать опята на части тоже нет необходимости — они и так небольшого размера.

Для заморозки подходят «идеальные» экземпляры

Как правильно мыть грибы

Опята моются после предварительной обработки в дуршлаге, под прохладной проточной водой. Если вы хотите удалить юбочку под шляпкой у опят, используйте более сильный напор.

Как мыть быстро?

Самый обычный способ — под проточной водой с помощью дуршлага — и есть самый быстрый.

Моем опята в дуршлаге

Видео: как правильно помыть и чистить опята?

Можно ли оставить вымытые опята на ночь?

Не стоит рисковать своим здоровьем и оставлять вымытые опята на ночь. Как уже говорилось, готовить грибы нужно сразу, как вы их собрали. Однако есть и другой вариант — залить опята кипятком на 10 минут, выложить в дуршлаг, промыть водой и убрать в холодильник. Грибы не совсем готовы, и из них всё ещё можно готовить — жарить, варить, мариновать. Тем не менее, они прошли тепловую обработку и уже точно не испортятся.

Вымачивание

Вымачивают опята после предварительной обработки в лесу и перед обрезанием нижней части ножек и промыванием очищенных опят водой.

Вымачивают опята для того, чтобы точно избавиться от мелких червячков, которых не видно даже при тщательном рассмотрении гриба. Как вымочить опята правильно? Придерживаемся следующей пропорции: на 1 литр воды мы берём 1 чайную ложку соли крупного помола, размешиваем до полного растворения соли и заливаем раствором грибы. Если наши подозрения подтвердились, и в грибах действительно были червячки — они погибнут и всплывут. Максимальное время замачивания — час (если опята большие, можно их оставить и на 2 часа). Если грибы не очень червивые, можно делать менее крутой раствор соли (по четверти чайной ложки на 1 литр).

Замачивание опят в солёной воде помогает избавиться от маленьких червячков

Видео: как замачивать и чистить опята?

В каких случаях нужно вымачивать опята?
  • Если мы солим опята? Обязательно вымачиваем их около двух часов в крутом соляном растворе.
  • Если мы варим опята? Можно их не вымачивать, но основное внимание уделить чистке и мойке опят.
  • Если мы маринуем опята? Замачивать их не обязательно, но при желании можно, сократив время до тридцати минут. Однако лучше их просто обдать кипятком, а перед этим хорошо промыть.
  • Если мы жарим опята? Можно вымочить, а можно пренебречь этим шагом.
  • Если мы сушим или замораживаем опята? Замачивать их не стоит ни в коем случае. Эти способы приготовления не любят «мокрых» опят.
Чистка опят (пошаговая инструкция)

Для чистки опят нам понадобятся влажная губка, дуршлаг и небольшой острый нож. Итак, приступим!

  1. Если опята достаточно чистые, без лишнего мусора, протираем их влажной губкой — и шляпку, и ножки.

    После обтирания губкой опята становятся почти чистыми

  2. Срезаем ножичком низ ножки, если на нём имеется грязь. Если опята старые, ножку обрезаем ближе к шляпке, примерно на 2/3.

    Можно отделить друг от друга шляпки и ножки

  3. Обрезаем на шляпке и ножке повреждённые места, если они остались после предварительной чистке опят в лесу.

    Обрезаем кусочки опят с червоточинами

  4. Удаляем ободок под шляпкой, если нам этого хочется (можем просто промыть опята под очень сильной струёй воды — нежная пленочка просто смоется).

    Удаляем юбочку под шляпкой у опят

  5. Помещаем грибы в дуршлаг и промываем опята под проточной водой (только в том случае, если мы их не сушим).

    Промываем опята в дуршлаге

  6. Опята почищены!
Видео: как правильно чистить грибочки?

Есть ли различия чистки для варки, жарки, маринования?

В подготовке опят нет особых различий для варки, маринования или жарки. Перед варкой или жаркой очищенные опята промывают в воде. Юбочки перед жаркой можно не убирать, так как под воздействием температуры они усыхают, становясь совсем незаметными. Перед варкой можно избавиться от них, если вы варите грибы целиком и оставить, если разрезаете опёнок на части — это просто вопрос внешнего вида. Что касается юбочек опят при мариновании, они имеют неприятное свойство расползаться и портить эстетический вид продукта — так что их лучше убрать.

Перед жаркой у опят можно не убирать юбочки

Нюансы очистки

Под шляпкой между пластинками у опят можно встретить мелких насекомых и жучков, поэтому, если опята не молодые, стоит их почистить. Можно использовать небольшую щётку и аккуратно, чтобы не повредить пластинки, пройтись ей от центра к краям, вычистив ненужную живность. Можно не пользоваться щёткой, но промыть опята под струёй воды, которая вымоет из-под шляпки насекомых, но это не подойдёт для тех грибов, которые вы собираетесь заморозить или засушить.

Не нужно чистить свежие молодые опята, которые не соприкасались с землёй — росли на пнях или на основаниях деревьев, они и без того чистые.

Молодые опята можно не чистить

Влажная губка и ножичек — наши верные друзья в быстрой чистке опят. Если мы не удаляем юбочку, это тоже придаёт нам скорости.

Чистить и мыть опята — совсем не сложное занятие, но требует много времени в том случае, если вы решаете убирать нежную юбочку из-под шляпки у каждого опёнка. Грибы эти приятные в обработке и очень вкусные, главное — их правильная подготовка к засолке, маринованию, жарке или варке. Пользуясь советами, данными в статье, вы подготовите опята должным образом. Готовьте с удовольствием!

Добрый день! Меня зовут Инна, я студентка, учусь на направлении юриспруденция. Написание статей на различные темы развивает меня и помогает в расширении кругозора, в наше время интересный человек — тот, кто достаточно хорошо осведомлён обо всём на свете, может поддержать разговор на любые темы и дать совет на интересующий вопрос. (1 голос, среднее: 3 из 5)

Поделитесь с друзьями в соц.сетях

Facebook

Twitter

Google+

Telegram

Vkontakte

Как почистить свежие опята: обработка после сбора

0

1140

Рейтинг статьи

Кира Столетова

Одной из популярных разновидностей грибов являются опята – они сохраняют своеобразный вкус в жареном, маринованном и в засоленном виде. Правильная предварительная обработка опят – важный этап, обязательный перед приготовлением, ведь на грибах скапливаются кусочки земли, травинки и листья.

Правила обработки свежих опят

Первичная обработка в лесу

Чтобы облегчить последующие этапы очистки, начинать процесс стоит прямо во время сбора. Это потребует временных затрат, но зато будет меньше работы дома. Следует сразу же отсеять из лукошка червивые и поврежденные экземпляры. С нижней части ножки удаляют острым ножом грязь, землю, хвою и налипшие веточки, обрезают низ. Обязательно срезают ту часть, которая испорчена червячками. Волнистый воротник (который мы еще называем юбочка) на ножке убирать необязательно – на вкусовых качествах приготовленного блюда это не отражается.

С нижней половины ножки аккуратно срезается та часть, которая крепила гриб к мицелию. Со шляпки удаляется пленка. Если гриб срезать, а не сорвать, то не придется удалять грязь и остатки мицелия с основания грибов. Наиболее вкусная часть – шляпки, поэтому от ножки можно избавиться и не обрабатывать самую грязную часть гриба.

Техника домашней чистки

Сразу после прогулки по лесу собранный урожай сортируют. Свежие опята, оторванные от грибницы, начинают быстро темнеть. Обработку откладывать нельзя более, чем на 3 ч после сбора, т.к. грибы очень быстро портятся. В пакете их оставлять не стоит. Правильно чистить опята сразу по приходу из леса. Если по каким-либо причинам своевременная очистка невозможна, урожай опускают в прохладную воду с добавлением ложки лимонной кислоты и таким же количеством поваренной соли.

Чтобы правильно чистить опята, понадобится острый ножик, дуршлаг и губка. Последняя нужна для протирания ножки и шляпки. С нижней части ножиком счищается грязь, в некоторых случаях срезается весь низ. Перед тем, как почистить, ножки отделяют от шляпок.

Все повреждённые места удаляются. Ободок под шляпой снимается или смывается струей воды. После все грибы тщательно промываются (если вы не собираетесь сушить их). Молодые опята чистить не требуется.

Последующие действия будут варьироваться, это зависит от способа приготовления. Очистка потребует наличие заточенного компактного ножа, щетку для зубов с жесткой щетиной и кусок мягкой ткани.

Ирина Селютина (Биолог):

Если вы собрали большой урожай, то лучше его разделить для обработки на несколько частей. Те опята, которые хотите оставить, можно поместить в прохладное помещение, куда нет доступа прямым солнечным лучам и выложить в один слой на газете. В таком состоянии они могут пролежать сутки, за это время частично подсохнут и их можно будет почистить сухим способом. Однако, все же лучше сразу же разобраться с грибами по возвращении из леса. Это сохранит урожай и поможет избежать в дальнейшем отравлений.

  1. Опята для сушки: в этом случае контакт грибов с водой исключается – впитанная влага не испарится из них полностью, поэтому качественного просушивания не состоится и как результат ваша заготовка не будет долго храниться. При помощи щетки тщательно прочесываются пластинки под шляпой – там могут сидеть жучки. Мягкой тканью счищаются остатки песка.
  2. Для маринования: потребуется предварительное вымачивание в жидкости на протяжении 40 минут (только нельзя держать более 1 ч – тогда опята потеряют часть своих вкусовых качеств). Экземпляры для такого способа обработки подбирают здоровые и крупные. «Юбочку» убирают. Затем продукты промывают под холодной струей не более 3-5 минут. Недавно выросшие опята нуждаются перед мытьем в получасовом вымачивании в воде с солью. Следующий этап – варка в подсоленной воде около 40 минут. После всех процедур разрешено приступать к обработке.
  3. Для заморозки: такой способ обработки требует только свежесобранных экземпляров. Грибы на заморозку отбираются тщательно, повреждения, даже незначительные, недопустимы. Жесткой щеткой гриб очищается от пылинок, веток и т.д. Маленькие опята не нуждаются в резке на мелкие кусочки. В воде грибы не промывают.

Ирина Селютина (Биолог):

Если опята сильно загрязнены, вам придется протереть каждую шляпку смоченной водой тканью или же старым кухонным полотенцем и оставить на 1 ч для просушки. Только после этого опята выкладывают контейнеры или пакеты порционно и отправляют в морозильную камеру. Если вы хотите, чтобы часть грибов была заморожена по отдельным экземплярам, тогда разложите опята на ровные поверхности подносов или разделочных досок, заморозьте и только после этого поместите в пакеты или контейнеры для хранения в морозильной камере.

Если вы собрали переросшие опята, то сразу же определитесь с их качеством. Если оно вас устраивает (внешний вид, запах) – оставляйте грибы для дальнейшей обработки. Лучшим вариантом приготовления из переростков будет грибная икра или паштет.

Техника мытья опят

Промытые грибы нужно сразу готовить

Сразу после того, как грибник закончил обрабатывать плодовые тела, он моет их под прохладной проточной водой, используя дуршлаг. Чтобы промыть опята и избавиться от «юбочки», напор увеличивают.

Не следует оставлять промытые свежие грибы на ночь. Если после сбора нет времени сразу приступать к готовке, урожай заливают кипяченой водой на 20 минут, раскладывают его вдоль дуршлага, обливают прохладной водой и выкладывают в холодильник. Подобная термическая процедура обеспечивает сохранность опят и гарантирует их долгое хранение.

Вымачивание опят

Вымачивание производится после предварительной обработки в лесу и перед срезкой низа ножек и промыванием под водой. Цель вымачивания – окончательное избавление от червяков. Понадобится 1 ч.л. соли на 1 л воды (в качестве профилактики – половина ложки). Соль должна полностью раствориться в жидкости. После того, как грибы будут залиты раствором, червяки всплывут на поверхность. От размера грибов зависит время вымачивания и форма обработки:

  • засолка: вымачивание в крутом соляном растворе в течение 2 ч;
  • варка: процедура необязательна, основное внимание уделяется чистке и мытью грибов;
  • маринование: урожай замачивают на 30 минут или обдают кипятком, сразу после чего его надо обработать;
  • жарка: вымачивание не требуется;
  • сушка: контакт с водой противопоказан.

Как почистить опята быстро и без усилий

Легкий способ почистить опята

Как быстро и без хлопот очистить и помыть опята.

Заключение

Обработка опят после сбора состоит из нескольких этапов, техника исполнения которых зависит от способа приготовления. Следуя инструкции, грибник способен очистить урожай от сора без повреждений. Качественная обработка позволит приготовить вкусное лакомство из собранных опят.

Что надо делать с опятами после сбора. Как чистить опята свежие перед варкой

В лесу самыми многочисленными грибами считаются опята. Растут они, как правило, большими группами, и собирать их намного проще, чем другие виды грибов. Они очень полезные для здоровья и широко применяются как в пищу, так и для медицины. Наиболее популярным способом их приготовления являются маринование и соление. Несмотря на их популярность, не многие люди знают, как собирать опята, а затем почистить для дальнейшего приготовления.

Эти «обитатели леса» растут практически во всех хвойных и лиственных лесах. Наиболее удачным временем для их сбора является сентябрь-октябрь. Растут они преимущественно на стволах деревьев и пнях, реже на земле. Вследствие этого они не так сильно загрязнены.

Процесс приготовления опят может быть самым разнообразным. При этом они сохраняют все свои витамины и полезные вещества. Для того чтобы после приготовления они были наиболее вкусными, нужно знать, как правильно чистить опята. Каждый грибник может рассказать вам несколько способов, но мы остановимся на наиболее популярных из них.

Как чистить свежие опята

Это не самые трудные грибы в плане их чистки. Весь этот процесс сводится к удалению подпорченных участков и срезанию длинных ножек, которые можно засушить и использовать как добавку к разным блюдам.

Чистка грибов перед варкой

Как только вы принесли их домой, сразу же нужно их перебрать, отбрасывая подгнившие, старые или испорченные насекомыми. С поверхности также снимают:

  • налипшие листья,
  • траву,
  • землю.

Часто бывает, что в корзину с обычными грибами попадают мелкие. Чистить их очень хлопотно, и это займёт много времени и сил. В данном случае нужно сразу же определиться, для чего вы будете их использовать, и уже исходя из этого перерабатывать. К примеру, если вы решили их засушить или заморозить, то не нужно мыть, а для прочих применений достаточно положить мелкие грибы на час в подсоленную и обязательно холодную воду.

Как чистить собранные осенью и зимой грибы

Процесс чистки и обработки опят, собранных осенью, немного отличается от других. Это обусловлено тем, что в эту пору времени они могут напитаться водой и их практически невозможно будет засушить. Если вы все-таки решитесь попробовать, то они могут заплесневеть и испортиться. Поэтому собранные осенью грибы лучше всего использовать для маринования.

Не все знают, что сбор опят можно проводить и в зимнее время. Этот процесс затрудняется тем, что шляпки грибов покрыты не только мелкой травой, но и опавшими листьями. Они примерзают к грибу, и отделить их можно только дома, когда весь лесной мусор оттает. Зимние опята отлично подходят не только для маринования, но и для засолки или жарки. Однако стоит отметить, что собранные в этот период грибы нельзя сушить.

Как чистить берёзовые, чешуйчатые и королевские
  • Как ни странно, но во многих странах королевские опята считают несъедобными и просто их выбрасывают. У нас же данный вид готовится практически так же, как и другие виды. Королевские опята растут на мёртвых деревьях и пнях, как правило, большими группами. Они большого размера, и при чистке это упрощает задачу. Все, что нужно сделать, — это убрать ножом или другим острым предметом чешуйки на шляпке и пленчатое кольцо. После этого грибы промывают в подсоленной воде, чтобы избавиться от песка и других мелких частиц. Наиболее оптимальным вариантом будет оставить их на два часа в воде, а затем сварить. Без этого есть данный вид грибов нельзя. Их широко применяют для приготовления супов и для начинки пирожков или пиццы.
  • Чешуйчатые опята имеют у себя на шляпках

Как чистить и мыть грибы опята после леса. Как чистить опята свежие перед варкой

Если требуется сохранить опята после сбора в лесу, в домашних условиях можно использовать морозильную камеру бытового холодильника. Перед заморозкой грибы предварительно подготавливают, промывая их и очищая от грязи. Закладывать их можно как свежими, так и после обжарки или отваривания. Приготовление домашней заготовки по всем правилам не отнимет много времени, а продукт сохранит свои вкусовые качества.

Заморозка

После сбора в лесу свежие опята, предварительно подготовив, можно сложить в морозильную камеру. Если нет возможности обработать их сразу, грибы должны лежать только в холодильнике. Потом их обязательно следует заморозить или законсервировать. Хранение опят более суток после сбора без обработки запрещено, так как в них начинают вырабатываться токсины. Подготавливают грибы к закладке в камеру следующим способом:

  1. 1. Срезанные опята хорошо промывают в холодной воде и чистят.
  2. 2. Их просушивают на бумажном полотенце.
  3. 3. Опята нарезают пластинами или кубиками.
  4. 4. Заготовку небольшими порциями помещают в пищевые пакеты или в контейнеры и ставят в камеру.

Оптимальная температура для хранения свежих грибов должна быть ниже -18 градусов. В морозильной камере продукт может лежать 6-8 месяцев без потери вкусовых качеств. Закладывать можно и целые грибы, не нарезая их.

Отваривание

Так как длительно хранить опята после сбора даже в холодильнике нельзя, лучше в первые же сутки из них что-нибудь приготовить. Например, продукт можно отварить, а затем заморозить. На выходе получится полуфабрикат, который останется только достать из камеры и добавить в готовящиеся блюдо. Этапы обработки:

  1. 1. Предварительно грибы следует хорошо промыть и почистить, отрезать шляпки от ножек.
  2. 2. До варки можно сохранить опята в холодильнике, но только сухими.
  3. 3. Вареный отбрасывают на дуршлаг.
  4. 4. Когда заготовка немного подсушится, ее раскладывают в контейнеры или в пищевые пакеты небольшими порциями, которые можно использовать за один раз, и замораживают.

Отварные грибы могут не портиться в камере до 8 месяцев.

Жарение

Таким способом можно приготовить самостоятельное блюдо, которое останется только разогреть в микроволновой печи и подать к столу или добавить в первое или второе при приготовлении. Времени на заготовку уйдет немного больше, но она достаточно удобна в дальнейшем использовании. В холодильнике можно сохранять жареный продукт 3 дня. Последовательность действий:

  1. 1. Опята после сбора хорошо промывают и чистят.
  2. 2. Нарезают пластинами.
  3. 3. Обжаривают на сковороде на растительном масле.
  4. 4. Когда продукт остынет, его перекладывают в контейнеры или пищевые пакеты.
  5. 5. Заготовку замораживают.

Жареные грибы можно хранить в морозильной камере при температуре ниже -18 градусов до 8 месяцев.

И немного о секретах…

История одной из наших читательниц Ирины Володиной:

Особенно удручали меня глаза, окруженные крупными морщинами плюс темные круги и отеки. Как в убрать морщины и мешки под глазами полностью? Как справиться с отеками и покраснением? А ведь ничто так не старит или молодит человека, как его глаза.

Но как их омолодить? Пластическая операция? Узнавала — не меньше 5 тысяч долларов. Аппаратные процедуры — фотоомоложение, газожидкостный пиллинг, радиолифтинг, лазерный фейслифтинг? Чуть доступнее — курс стоит 1,5-2 тысяч долларов. И когда на все это время найти? Да и все равно дорого. Особенно сейчас. Поэтому для себя я выбрала другой способ…

Опята – наиболее распространенные из лесных грибов, в том числе и потому что растут группами, а не по одному. Их просто собирать, они представлены в регионах с разным климатом, содержат в себе вещество фламмулин, предотвращающее саркому, большое количество витаминов группы В, витамина Е, РР, аскорбиновой кислоты, в ножках много клетчатки, полезной для пищеварения, поэтому опята очень популярны среди людей и являются ингредиентом многих блюд. Из этих грибов можно готовить супы, вторые блюда, закуски. Подходят они также для маринования и соления. Несмотря на такую большую популярность, вопрос, к

Как чистить опята? Расскажем про обработку и засолку этих полезных грибов. Как чистить и мыть грибы опята после леса

Лесные опята любят и в жареном, и в маринованном виде. Но как правильно чистить грибы, далеко не все грибники со стажем знают. Раскроем некоторые хитрости, чтобы процесс обработки не доставил хлопот.

Как нужно чистить опята

Считается, что выросшие на пнях опята в очистке не нуждаются. Но это не так. Обработку любые грибы требуют. Ведь даже на пригодных к употреблению грибах могут быть повреждённые места, от которых нужно избавляться. Кроме того, под шляпкой зачастую можно найти маленьких жучков. Поэтому стоит потратить время на очистку, рассортировать.

Нужно ли чистить в лесу

Опытные грибники очистку начинают ещё в лесу:

  • Грибы перебирают, удаляя червивые и повреждённые экземпляры.
  • С собранных опят удаляют мусор, веточки, налипшие листья.
  • Острым ножом обрезают нижние части ножек с остатками песка и земли.

Собирая урожай опят не рвите, а срезайте, чтобы дома не пришлось чистить и удалять их основания, загрязненные землей и древесной трухой

Чтобы облегчить себе работу, собирайте только шляпки. Тогда не придётся очищать ножки. Скользкой пленочки на шляпке у опят нет. Значит, и снимать её не придётся.

Чистим дома

Никаких сложных манипуляций дома проделывать не требуется, тем более если в лесу грибы уже немного обработали. Важно только начать очистку сразу, не оставляйте грибы в холодильнике или в пакете — так опята быстро темнеют.

Сначала подготовьте «инструменты» для обработки:

  • острый нож;
  • старую зубную щётку, салфетку или мягкую губку;
  • дуршлаг;
  • воду.

Приступаем к чистке:

  1. Собранный урожай тщательно переберите, удаляя жёсткую волокнистую ножку у зрелых крупных грибов.

    Опята сортируют для обработки

  2. Очистите влажной губкой или старой зубной щёткой, сметая мусор со шляпок и ножек.

    С грибов счищают грязь кухонной губкой

  3. Не получилось убрать грязь — срезаем.

    Срезают нижнюю половину ножки, даже если она хорошая, так как ножки у опят бывают твердоваты

  4. Со шляпок срезаем повреждения. Удаляем юбочки под шляпками.

    Освобождаем шляпку от плёночного кольца

  5. Опята промываем, если они не предназначены для сушки.

    Опята промывают снова после обработки

  6. Готово.

    Вот теперь можно готовить

Чтобы избавиться от остатков сора и грязи, опята тщательно промывают не один раз. Можно очищать опята в тёплой воде не дольше 10–15 минут. Очень горячая вода не годится. Перед тепловой обработкой рекомендуется промывать, а не замачивать.

Необходимо ли замачивать опята на ночь

Вымачивают обычно те грибы, которые содержат горечь, это грузди, волнушки, горькушки. Меняют воду в течение нескольких дней. Опята нежные и вкусные грибы без горечи. Иногда не получается сразу обработать грибы. В этом случае, оставьте опята в прохладном тёмном месте (подвал, погреб или холодильник) не дольше 6 часов. Специалисты считают, что свежие опята вообще не пригодны для хранения, поэтому при первой возможности сразу же обработайте их.

Правильная очистка опят при разных способах приготовления

Правильная очистка опят зависит от способа их приготовления. Предварительно удаляют мусор.

Предназначенные для варки грибы промывают, оставляют плёнку-юбочку под шляпкой. Её присутствие ни на вкусе, ни на аромате, ни на полезных свойствах кушанья не скажется. Но в супе она разбухнет и станет склизкой, убрать можно ножом с тонким лезвием, либо зубной щёточкой.

Если опята готовят для жарки, то после предварительной очистки нужно только промыть грибы. От юбочки не освобождают: она при жарке усохнет, став незаметной.

Плёнку непременно снимают перед маринованием и посолом. В маринаде «юбочка» разбухает, портя внешний вид кушанья. И нижние части шляпок, и ножки тщательно чистят ножом либо щёточкой. Далее — тщательное промывание.

Перед заморозкой и сушкой грибы не вымывают, так как в воде они размокнут, станут водянистыми. Есть риск, что опята потемнеют. Да и сушить набравшие влагу грибы придётся дольше. Поверхность должна быть сухой. После первичной очистки шляпки и ножки аккуратно протирают мягкой губкой, а пленочки удаляют щёточкой. При замораживании промывание тоже не нужно.

Таблица: различия в промывании и обработке опят при разных способах приготовления

Как чистить опята свежие перед варкой. Съедобные грибы опята – секреты сбора и правила приготовления

Опята считаются одними из самых «урожайных» грибов — ведь их легко и быстро можно собрать целую корзину. Они растут не по одиночке, а большими группами на старых пнях и корнях, поднимающихся из-под земли, в буреломе и на живых деревьях. Их можно отличить от ложных грибов по характерным особенностям.

Все без исключения опята имеют кольцо на ножке, в верхней ее части. Шляпка может быть коричневатой, желтоватой или буро-серой. Она достигает 15 см в диаметре и с течением времени становится более плоской. Центральная часть шляпки, как правило, имеет более темный насыщенный окрас. Мякоть у гриба беловатая, имеет приятный аромат. Ножка опенка достигает 10 см в длину и в 2 см в толщину. Массовый сбор этих вкусных и полезных грибов начинается с конца августа. Опята используются в приготовлении супов, вторых блюд, различных закусок. Эти грибы прекрасно подходят и для маринования, и для соления. В этой статье мы поделимся несколькими секретами приготовления, а также расскажем, как чистить опята. На самом деле, в этом нет ничего сложного.

Как чистить опята в домашних условиях?

После того как вы соберете и принесете грибы домой, советуем обработать их оперативно. И чем скорее вы это сделаете, тем лучше. Опята считаются одними из самых легко очищаемых грибов, ведь они практически не требуют скобления. Обычно, опята перебирают, убирают прилипшие листья, травинки и прочий имеющийся мусор.

Как чистить опята: острым ножом следует аккуратно удалить имеющуюся под шляпкой гриба пленочку. Вот, собственно, и все. Кроме этого, нужно срезать плохие места и убрать червоточины. После этих манипуляций опята слегка промываются в прохладной воде. Советуем делать это, помещая грибочки в дуршлаг и давая стечь воде. Теперь вы знаете, как чистить опята правильно. Видите, это совсем просто. Обработка этих грибов не займет у вас слишком много времени.

Что делать с опятами и как их готовить?

Опята вкусны и маринованные, и жареные, и соленые. Предлагаем вам прекрасный рецепт — «осенние серые опята». Для этой холодной закуски вам потребуются ингредиенты, такие как:

  • опята — 5 кг;
  • соль — 250 г;
  • лавровый лист — 10 г;
  • душистый перец горошком — 60 шт.;
  • зеленый укроп — 90г;
  • лук — 90 г.

Итак, рецепт холодной засолки опят таков: обработайте и промойте грибы. Обрежьте все плохие места. Отделите шляпки от ножек. Нарежьте грибы на небольшие кусочки толщиной 1-1,5 см. Опустите их в подсоленную кипящую воду (1 ст.л. соли на 2 л жидкости) и проварите около 20-30 минут. Готовые опята должны осесть на дно емкости. После этого переложите опята в дуршлаг и оставьте их остывать. Подготовьте посуду для засаливания. Положите на ее дно слой пряностей: укроп, лук измельченный, лавровый лист, перец горошком. После охлаждения выложите грибы сверху на пряности слоем толщиной в 5 см. Снова повторите слой пряностей и насыпьте соль. Точно так же выложите еще несколько слоев. Накройте заготовку салфеткой и положите грузик. Все, теперь можно оставить грибочки в покое — просаливаться. Спустя 5 дней можно будет переложить опята в стеклянные банки и закрыть их пластиковыми крышками. Через три недели опята будут готовы. Хранить такую превосходную закуску необходимо в холодильнике. Приятного аппетита!

Опята ― это вкусный источник полноценных белков, цинка, железа, фосфора и витамина С. Употребление этих грибов помогает организму преодолевать вирусные заболевания, и наполнятся жизненной силой. Но многие хозяйки избегают этот лесной продукт, ссылаясь на сложность очистки и приготовления опят. На самом деле тут нет ничего сложного.

Как очистить опята

Опята ― скоропортящийся продукт, поэтому его очистку нужно начинать сразу после возвращения из лесу, ну или с магазина. Грибы очень хрупкие и небольшие, но процесс очистки не займет много сил:

  • Переберите урожай. Все гнилые, трухлявые и поврежденные насекомыми экземпляры без зазрения совести отправляйте в мусорное ведро.
  • Удалите органический «мусор» ― веточки, листики, землю.
  • Далее нужно определить, какой обработке будут подвергаться грибы. Если вы хотите их сушить, срежьте нижний сегмент ножки и удалите пленку под шапочкой. Если грибы требуются в свежем виде, дополнительно их стоит замочить в воде (максимум 1 час), а потом очистить пленку (юбочку).

Как приготовить отварные опята

После очистки можно приступать к термической обработке грибов:

  • Возьмите эмалированную кастрюлю и вскипятите в ней подсоленную воду.
  • Отправьте грибы в кипящую воду на 10 минут, при этом обязательно снимайте пенку.
  • Слейте грибной отвар и залейте грибы чистой водой.
  • После закипания проварите грибы 30-40 минут.
  • Когда опята полностью приготовятся, они осядут на дно посуды.
  • Откиньте грибы на дуршлаг и промойте их водой. Это позволит смыть лишнюю слизь.

Как приготовить жареные опята

По

Как правильно собирать и чистить грибы

В лесу самыми многочисленными грибами считаются опята. Растут они, как правило, большими группами, и собирать их намного проще, чем другие виды грибов. Они очень полезные для здоровья и широко применяются как в пищу, так и для медицины. Наиболее популярным способом их приготовления являются маринование и соление. Несмотря на их популярность, не многие люди знают, как собирать опята, а затем почистить для дальнейшего приготовления.

Эти «обитатели леса» растут практически во всех хвойных и лиственных лесах. Наиболее удачным временем для их сбора является сентябрь-октябрь. Растут они преимущественно на стволах деревьев и пнях, реже на земле. Вследствие этого они не так сильно загрязнены.

Процесс приготовления опят может быть самым разнообразным. При этом они сохраняют все свои витамины и полезные вещества. Для того чтобы после приготовления они были наиболее вкусными, нужно знать, как правильно чистить опята. Каждый грибник может рассказать вам несколько способов, но мы остановимся на наиболее популярных из них.

Как чистить свежие опята

Это не самые трудные грибы в плане их чистки. Весь этот процесс сводится к удалению подпорченных участков и срезанию длинных ножек, которые можно засушить и использовать как добавку к разным блюдам.

Чистка грибов перед варкой

Как только вы принесли их домой, сразу же нужно их перебрать, отбрасывая подгнившие, старые или испорченные насекомыми. С поверхности также снимают:

  • налипшие листья,
  • траву,
  • землю.

Часто бывает, что в корзину с обычными грибами попадают мелкие. Чистить их очень хлопотно, и это займёт много времени и сил. В данном случае нужно сразу же определиться, для чего вы будете их использовать, и уже исходя из этого перерабатывать. К примеру, если вы решили их засушить или заморозить, то не нужно мыть, а для прочих применений достаточно положить мелкие грибы на час в подсоленную и обязательно холодную воду.

Как чистить собранные осенью и зимой грибы

Процесс чистки и обработки опят, собранных осенью, немного отличается от других. Это обусловлено тем, что в эту пору времени они могут напитаться водой и их практически невозможно будет засушить. Если вы все-таки решитесь попробовать, то они могут заплесневеть и испортиться. Поэтому собранные осенью грибы лучше всего использовать для маринования.

Не все знают, что сбор опят можно проводить и в зимнее время. Этот процесс затрудняется тем, что шляпки грибов покрыты не только мелкой травой, но и опавшими листьями. Они примерзают к грибу, и отделить их можно только дома, когда весь лесной мусор оттает. Зимние опята отлично подходят не только для маринования, но и для засолки или жарки. Однако стоит отметить, что собранные в этот период грибы нельзя сушить.

Как чистить берёзовые, чешуйчатые и королевские
  • Как ни странно, но во многих странах королевские опята считают несъедобными и просто их выбрасывают. У нас же данный вид готовится практически так же, как и другие виды. Королевские опята растут на мёртвых деревьях и пнях, как правило, большими группами. Они большого размера, и при чистке это упрощает задачу. Все, что нужно сделать, — это убрать ножом или другим острым предметом чешуйки на шляпке и пленчатое кольцо. После этого грибы промывают в подсоленной воде, чтобы избавиться от песка и других мелких частиц. Наиболее оптимальным вариантом будет оставить их на два часа в воде, а затем сварить. Без этого есть данный вид грибов нельзя. Их широко применяют для приготовления супов и для начинки пирожков или пиццы.
  • Чешуйчатые опята имеют у себя на шляпках большое количество чешуек, и процесс их чистки идентичен королевским. Перед тем как их жарить или тушить, необходимо грибы сварить в течение получаса.
  • Березовые опята отлично подходят для засолки или маринования. Они растут только на березах или берёзовых пнях большими группами, и собирают их в летние месяцы. Весь процесс их чистки заключается в удалении непригодных и червивых частей, а также пленчатого кольца. Перед готовкой обязательно промойте их в воде.
Как варить опята

После вымачивания в соленой воде грибы нужно хорошо промыть и дать им немного высохнуть. Для процесса варки вам понадобится эмалированная кастрюля. Укладываем их туда и полностью заливаем их водой. Как только вода закипит, засекаем 30−40 минут и варим их. Чем больше грибы по размеру, тем дольше их нужно отваривать.

Как правильно почистить для маринования

Перед тем как очищать грибы для маринования, их нужно замочить на полчаса в теплой воде. Это упростит процесс их обработки. С грибов убирают юбочку-кольцо и срезают большую часть ножки. Также не забывайте удалять все непригодные для пищи части. Еще одним способом обработки перед маринованием является их очищение с помощью кухонной губки. Так как опята сами по себе чистые, то этот метод вполне пригоден для обработки. Далее грибы маринуют всеми известными способами.

Правила очистки перед жаркой

Процесс очистки опят перед жаркой значительно отличается от обработки перед маринованием или засолкой. После того как они попали к вам домой, их следует тщательно перебрать и снять с их шляпок весь мусор. Также будет не лишним срезать кончик ножки и все поврежденные части. Бывает, что под шляпкой находятся насекомые, поэтому стоит просматривать и эти места. Перед жаркой грибы не стоит промывать, так как они наберутся воды и потеряют свою форму при термообработке. Также можно грибы предварительно отварить, но это может уменьшить их уникальные вкусовые качества.

Как правильно чистить грибы перед заморозкой

Одним из наиболее популярных способов хранения грибов является их заморозка. Для нее больше всего подходят пеньковые опята. Их предварительную очистку нужно делать в лесу, сразу же после сбора. Следует отметить, что опята можно заморозить не только в свежем виде, но и жареными или немного отваренными. Во всех этих вариантах чистка проходит примерно одинаково. Сначала с грибов срезают все гнилые части и срезают кончик ножки. Затем их тщательно промывают, раскладывают и дают им просохнуть. Последним этапом заморозки будет их распределение и помещение в морозильную камеру.

Опята — очень ценные и полезные грибы, и собирать их нужно только в том случае, если вы точно знаете, как их правильно обработать и приготовить. Если вы не поленитесь и правильно все сделаете, то в награду получите вкуснейший продукт.

‘;blockSettingArray[2][«setting_type»] = 1;blockSettingArray[2][«element»] = «h4»;blockSettingArray[2][«elementPosition»] = 1;blockSettingArray[2][«elementPlace»] = 2;blockSettingArray[3] = [];blockSettingArray[3][«minSymbols»] = 0;blockSettingArray[3][«minHeaders»] = 0;blockSettingArray[3][«text»] = ‘

‘;blockSettingArray[3][«setting_type»] = 1;blockSettingArray[3][«element»] = «h4»;blockSettingArray[3][«elementPosition»] = 1;blockSettingArray[3][«elementPlace»] = 3;var jsInputerLaunch = 15;

Что делать с опятами после сбора

Любителей тихой охоты, особенно начинающих, интересует вопрос: что делать с опятами после сбора, как их правильно собирать, перерабатывать, что вкусного приготовить из грибов и если их много, как сохранить продукт до следующего сезона. Простые советы помогут сполна насладиться результатом активного отдыха и вкусно накормить семейство.

Опята – где растут и когда собирать?

Новичков, которые впервые оказались в лесу, одолевает чувство растерянности, с которым гораздо легче справиться, владея базовой информацией о грибах. Зная, как собирать опята, удастся сэкономить время при их переработке, и избавить себя от необходимости лишний раз перебирать грибную массу и срезать лишнее.

  1. Опята сполна оправдывают свое название и растут на старых пнях или очень редко на старых деревьях или у их основания.
  2. Данный грибной вид распространен в лиственных лесах и практически не встречается в хвойных.
  3. При сборе грибов предпочтение следует отдавать некрупным молодым экземплярам, срезая их вместе с ножками, немного выше от грибницы.
  4. У крупных грибов-переростков вкусны только шляпки, а ножки жесткие и немного резиновые на вкус.

Как правильно чистить опята?

Набрав полные лукошки щедрых даров леса, и добравшись с ощущением приятной усталости до дома, останется только переработать грибное изобилие. Всегда хочется это сделать с минимальными трудозатратами и знания, как чистить опята быстро помогут справиться с задачей в лучшем виде.

  1. Если грибы были собраны правильно, много времени чистка не займет. Останется только перебрать грибную массу, удалив при наличии порченые или червивые экземпляры.
  2. Собирая опята второпях, зачастую остаются на ножках части грибницы, которые нужно срезать.
  3. Определенные виды опят имеют чешуйки на шляпках, которые желательно поскоблить ножом или обтереть салфетками.
  4. Как правило, опята не требуют особого подхода при чистке, и их переработка в большинстве своем будет зависеть от дальнейшего предназначения. Например, для заморозки отбирают самые чистые опята без песка и мусора и по возможности их не моют, а просто вытирают бумажным полотенцем. Грибную массу с частичками земли и другими загрязнениями лучше сполоснуть в воде и дать стечь.

Как варить свежие опята?

Переработать опята предпочтительно в первые сутки после сбора. Хранить их в свежем виде допускается не более двух дней. Перед засолкой, маринованием или добавлением в блюда лесные грибы предварительно отваривают.

  1. Перебирают и промывают грибную массу, оставляют в дуршлаге для стекания.
  2. Кипятят воду, добавив в нее столовую ложку соли на два литра жидкости.
  3. Закладывают подготовленные грибы, дают содержимому кастрюли повторно закипеть, снимая пену.
  4. Сколько времени варить опята зависит от размера и степени зрелости грибов. Признаком готовности будет опускание грибной массы на дно. Как правило, варка занимает около получаса.

Что можно сделать с опятами?

Разобравшись, что делать с опятами после сбора, и правильно их подготовив к дальнейшему приготовлению, можно приступать к исполнению рецептов для получения вкусных закусок или самостоятельных блюд. Популярные версии применения опят в кулинарии или заготовки их впрок помогут использовать продукт максимально результативно.

  1. Рецепты с опятами могут предполагать их варку с последующим тушением, жаркой, а также заготовку впрок в виде маринованной закуски или икры.
  2. Многокомпонентные блюда с опятами, где грибы сочетаются с овощами или мясом, порадуют великолепными вкусовыми и питательными характеристиками, потрясающим насыщенным ароматом.
  3. Рецепты с опятами на зиму включают длительную стерилизацию заготовок, которые впоследствии можно герметично укупоривать. Без стерилизации сосуды можно хранить в холоде под неплотно прикрытыми крышками.
Как мариновать опята на зиму с уксусом?

Простой рецепт маринованных опят с уксусом позволит сохранить любимые грибы до следующего сезона и обеспечить семейство вкуснейшей закуской. Набор пряностей допускается составлять исходя из индивидуальных пристрастий, добавляя новые пикантные компоненты по вкусу или заменяя ими предложенные.

Ингредиенты:

  • опята – 1,5 кг;
  • вода – 3 стакана;
  • сахарный песок – 4 ч. ложки;
  • соль – 2 ст. ложки;
  • уксус – 1/3 стакана;
  • лавр, душистый перец, гвоздика, чеснок, растительное масло.

Приготовление

  1. Опята отваривают 20 минут, промывают, дают стечь.
  2. Кипятят воду с добавлением соли, сахара, специй и пряностей.
  3. Вливают уксус, закладывают грибы и варят 30 минут.
  4. Раскладывают грибную массу с маринадом в банки, стерилизуют их 20 минут, укупоривают, тепло укутывают до остывания.
Как сушить опята?

Великолепной зимней заготовкой станут сушеные опята. Их можно применять для варки первых блюд, добавлять в салаты, другие кулинарные композиции. Нужно просто замочить продукт на несколько часов, после чего отварить до полной готовности в течение 30 минут.

  1. Перед сушкой опята не желательно мыть, а только обтереть салфетками или бумажными полотенцами.
  2. Грибы можно нанизать на нитки и высушить при хорошей погоде в естественных условиях на чердаке или под навесом.
  3. Подобные связки сушат и в сухих проветриваемых теплых помещениях.
  4. Более современный способ сушки опят – применение электросушилки. Грибные экземпляры раскладывают на поддонах и сушат при температуре 50 градусов до выпаривания влаги.
  5. Высушить грибы можно в духовке: опята раскладывают на противне и помещают в разогретое до 60 градусов устройство на 4-7 часов. Дверца при этом должна быть немного приоткрыта.
Как правильно заморозить опята на зиму?

Изучая, что можно делать с опятами после сбора, многих привлекают рекомендации по заморозке продукта. При наличии свободного места в холодильнике и катастрофической нехватке времени данный способ заготовки является одним из самых приоритетных. О том, как заморозить опята свежие на зиму, в следующих пунктах:

  1. Грибы желательно не мыть, а просто протереть полотенцем или салфетками, а мусор или немногочисленный песок счистить щеткой.
  2. Опята раскладывают одним слоем в камере, подмораживают, после чего ссыпают в пакет для хранения и окончательной заморозки.
  3. Замораживать можно и уже отваренные или обжаренные грибы, разложив их в порционные пакеты или емкости.
Как варить суп из опят?

Суп с опятами, рецепт которого будет изложен далее, можно сварить исключительно с овощами или добавить в состав крупу, макаронные изделия. Вкусным и питательным горячее будет, если в качестве жидкой составляющей взять мясной бульон, а при подаче в тарелки положить нарезанное некрупными ломтиками отваренное мясо.

Ингредиенты:

  • опята – 0,5 кг;
  • вода или бульон – 2 л;
  • картофель – 4-6 шт.;
  • лук и морковь – по 1 шт.;
  • лавр, горошины перца, соль, зелень – по вкусу;
  • масло – 40 г.

Приготовление

  1. Отваривают опята 20 минут, откидывают на сито, перекладывают в кипящий бульон.
  2. Добавляют картофельные кубики, а через 10 минут варки вводят пассеровку из лука и моркови.
  3. Приправляют горячее по вкусу, варят 10 минут, подают с зеленью и по желанию со сметаной.
Как пожарить опята с луком?

Рецепты с опятами свежими исполняются без предварительного отваривания только при уверенности в качестве грибов и их экологической чистоте. При наличии такого продукта можно пожарить его с добавлением лука и сметаны. Изумительный насыщенный вкус и потрясающий аромат блюда достоин самой высокой похвалы.

Ингредиенты:

  • опята – 800 г;
  • лук – 1 шт.;
  • сметана – 200 г;
  • масло – 70 г;
  • соль, перец, зелень.

Приготовление

  1. Подготовленные грибы закладывают в сковороду, заливают стаканом воды и припускают под крышкой 20 минут.
  2. Открывают крышку, выпаривают влагу.
  3. Добавляют масло, нарезанный лук, обжаривают компоненты до румянца, вмешивают сметану.
  4. Приправляют опята жареные с луком и сметаной по вкусу солью, перцем, зеленью, прогревают минуту и дают немного настояться.
Как пожарить опята с картошкой?

Неизменная классика, которая не теряет популярности с течением времени – картошка, жареная с грибами. Вкус кулинарной композиции даже без дополнительных приправ и пряных добавок радует неподражаемой гармонией. Зачастую состав дополняют луком, а для пикантности в конце жарки можно добавить мелко нарубленный чеснок.

Ингредиенты:

  • опята – 800 г;
  • лук – 1 шт.;
  • картофель – 1,5 кг;
  • масло – 100 мл.

Приготовление

  1. Отваривают опята до готовности, откидывают на дуршлаг.
  2. Подрумянивают на масле лук, добавляют грибы, выпаривают влагу.
  3. Закладывают очищенный и нарезанный некрупно картофель и жарят составляющие, помешивая.
  4. Картошка с опятами будет готова, когда ломтики овоща станут мягкими.
Салат с жареными опятами

Если есть желание приготовить салат с грибами, курица с опятами – беспроигрышное сочетание. Дополнив компоненты нарезанным или тертым сыром, орехами мелко нарубленным чесноком и заправив майонезом, удастся получить великолепную закуску, которая и в праздничном меню займет не последнее место. По желанию блюдо можно оформить слоями, покрывая каждый майонезной сеткой, после чего оставить на несколько часов для пропитки.

Ингредиенты:

  • опята – 700 г;
  • куриное филе – 0,5 кг;
  • сыр – 200 г;
  • орехи – неполный стакан;
  • чеснок – 2 зубка;
  • соль, перец, майонез, масло.

Приготовление

  1. Отваривают до готовности, а затем обжаривают на масле опята.
  2. Мелко нарезают отваренную курятину, добавляют к грибам.
  3. Туда же отправляют сыр, орехи, чеснок.
  4. Приправляют салат солью, перцем, майонезом, перемешивают, дают настояться.
Паста с опятами

Изысканным блюдом для домашней трапезы по поводу или без станет паста с опятами в сливочном соусе. Дополнительный пикантный вкус придаст яству сушеный или свежий базилик, щепотка итальянских или прованских трав. Не менее популярна версия с чесноком, который добавляют на завершающем этапе готовки.

Ингредиенты:

  • опята – 0,5 кг;
  • паста – 0,5 кг;
  • куриное филе – 250 г;
  • сыр плавленый и твердый – по 150 г;
  • сливки – 200 мл;
  • лук – 100 г;
  • карри, соль, перец, масло, зелень.

Приготовление

  1. Обжаривают по отдельности нарезанную курятину и предварительно отваренные опята с луком.
  2. Соединяют мясо и грибную поджарку, добавляют сливки, плавленый сыр.
  3. Приправляют соус по вкусу, протушивают 5 минут, вмешивают перетертый твердый сыр и отваренную пасту.
  4. Подают блюдо незамедлительно, разложив по теплым тарелкам и приправив зеленью.
Икра из опят с чесноком – рецепт

Икра из опят с чесноком может быть приготовлена из некондиционных экземпляров, обрезанных ножек или зрелых грибов, которые малопригодны для других блюд и заготовок. Полученная закуска – великолепное дополнение к ломтику свежего хлеба, компонент для создания начинки в выпечку или добавка к другим блюдам.

Ингредиенты:

  • опята – 0,5 кг;
  • морковь – 100 г;
  • лук – 200 г;
  • чеснок – 3 зубка;
  • соль, перец, масло.

Приготовление

  1. Опята отваривают 20 минут, после чего обжаривают на масле с добавлением лука.
  2. Отдельно припускают на масле перетертую морковь.
  3. Соединяют грибы с луком, морковь и чеснок в блендере, измельчают.
  4. Солят икру, перчат, перемешивают, дают немного настояться.
Жульен с опятами – рецепт

Жульен с опятами – блюдо для праздничного меню, которым можно побаловать семейство и в будни. Восхитительный насыщенный вкус лакомства с французскими корнями невозможно испортить, особенно, если выбрать для исполнения рецепта качественный натуральный сыр, домашнюю сметану. При подаче украшают яство зеленью.

Ингредиенты:

  • опята – 1,2 кг;
  • лук – 300 г;
  • сметана – 300 г;
  • сливочный сыр – 200 г;
  • масло – 70 г;
  • мука – 30 г;
  • соль, перец, зелень.

Приготовление

  1. Обжаривают на масле лук, добавляют муку, пассеруют 2 минуты.
  2. Закладывают предварительно отваренные до готовности опята, сметану, перемешивают и прогревают немного.
  3. Раскладывают массу по промасленным кокотницам, посыпают сыром и запекают при 180 градусах 7-10 минут.
Пирог с опятами – рецепт

Следующий рецепт для тех, кто не прочь побаловать себя домашней выпечкой. В качестве начинки в данном случае используются отваренные, а затем обжаренные опята. Грибную массу можно по желанию дополнить спассерованным на масле луком, а вместо песочного теста, приготовленного из указанных ингредиентов, взять готовое слоеное тесто.

Ингредиенты:

  • мука – 3 стакана;
  • масло – 200 г;
  • сметана – 150 г;
  • яйца – 2 шт.;
  • желток – 1 шт.;
  • опята – 1,5 кг;
  • соль, перец, зелень.

Приготовление

  1. Растирают муку с мягким маслом и щепоткой соли.
  2. Добавляют яйца и пару ложек сметаны, замешивают тесто, разделяют на 2 неравных части.
  3. Отваривают, а затем обжаривают опята, приправляют, смешивают с зеленью.
  4. Выкладывают массу на больший пласт теста, уложенный в форму, прикрывают меньшим пластом, делают сверху несколько разрезов, смазывают поверхность изделия желтком.
  5. Пекут пирог с опятами при 180 градусах до румянца.
  6. В разрезы заливают приправленную солью и перцем оставшуюся сметану, запекают изделие еще 5 минут.

 

правила сбора для быстрой очистки свежих грибов

Пик численности опят приходится на конец лета и начало осени. В этот сезон массового созревания многим удается набрать их в количестве, достаточном для обильных грибных пиршеств и заготовок впрок. При этом важно знать, как чистить опята быстро, качественно, в соответствии со способом дальнейшей обработки. Рассмотрим подробнее все варианты этого процесса.

Правила сбора опят и их подготовка к дальнейшей переработке

Еще на стадии сбора можно и нужно позаботиться о том, чтобы при чистке опят не было лишних хлопот. Прежде всего, надо правильно определять эти грибы, отличая от сходных несъедобных и ядовитых родственников, также заселяющих пни и плодоносящих в тот же сезон. Главный признак, которым отмечен съедобный опенок — пленчатое кольцо на ножке (у молодых грибов оно закрывает низ шляпки).

Собирая грибной урожай с пня или с валежника, лучше всего не рвать, а срезать плодовые тела. Тогда дома не придется чистить и удалять их основания, загрязненные землей и древесной трухой. Складывать плодовые тела лучше всего в плетеную корзину или в ведро. В мешке они быстро отмокают, повреждаются, теряют форму и товарный вид.

Как правильно чистить опята при разных способах приготовления

Свежие опята, принесенные домой, следует сразу перебрать, избавляясь от червивых, поврежденных и подпорченных. Основания ножек, если они сохранились, нужно обрезать. У зрелых экземпляров волокнистую жестковатую ножку укорачивают примерно на две трети или вовсе избавляются от нее.

Песчинки, комочки почвы и древесного субстрата с поверхности плодовых тел окончательно удаляют сухой кухонной губкой или зубной щеткой.

Дальнейшая чистка зависит от последующего приготовления. Рассмотрим все возможные варианты:

  1. Если грибы предназначены для супа-пюре, с их ножки можно не удалять пленчатое кольцо. Оно не влияет на вкус, аромат и полезные свойства грибной мякоти. Если же в супе должны быть цельные грибы, пленки обязательно снимают. Удобнее всего чистить их ножом с тонким лезвием либо зубной щеткой. Подготовленные плодовые тела промывают, а затем отправляют в суп.
  2. Для жарки опята, прошедшие предварительную очистку, только моют. Пленчатые кольца можно не чистить, так как при поджаривании они усыхают, становясь незаметными.
  3. Перед маринованием следует избавиться от пленок, которые разбухают в маринаде и портят вид заготовки. Поэтому ножки и нижние части шляпок нужно почистить ножичком или зубной щеткой. Затем грибы промывают и приступают к маринованию.
  4. Для сушки используется исключительно сухая чистка, при которой поверхность опят после первичной обработки протирают мягкой тряпочкой, а пленчатые покрывала и их остатки удаляют щеточкой.

Совет. Не держите опята в воде слишком долго, напитавшись ей, они потеряют свой вкус.

При массовом приготовлении, консервировании и сушке опят, особенно важна их тщательная и в то же время не слишком утомительная чистка. Она будет именно такой, если соблюдать необходимые правила сбора и обработки этих грибов.

Нужно ли обрезать ножки у опят. Как чистить и мыть грибы опята после леса

Любителей тихой охоты, особенно начинающих, интересует вопрос: что делать с опятами после сбора, как их правильно собирать, перерабатывать, что вкусного приготовить из грибов и если их много, как сохранить продукт до следующего сезона. Простые советы помогут сполна насладиться результатом активного отдыха и вкусно накормить семейство.

Опята – где растут и когда собирать?

Новичков, которые впервые оказались в лесу, одолевает чувство растерянности, с которым гораздо легче справиться, владея базовой информацией о грибах. Зная, как собирать опята, удастся сэкономить время при их переработке, и избавить себя от необходимости лишний раз перебирать грибную массу и срезать лишнее.

  1. Опята сполна оправдывают свое название и растут на старых пнях или очень редко на старых деревьях или у их основания.
  2. Данный грибной вид распространен в лиственных лесах и практически не встречается в хвойных.
  3. При сборе грибов предпочтение следует отдавать некрупным молодым экземплярам, срезая их вместе с ножками, немного выше от грибницы.
  4. У крупных грибов-переростков вкусны только шляпки, а ножки жесткие и немного резиновые на вкус.

Как правильно чистить опята?

Набрав полные лукошки щедрых даров леса, и добравшись с ощущением приятной усталости до дома, останется только переработать грибное изобилие. Всегда хочется это сделать с минимальными трудозатратами и знания, как чистить опята быстро помогут справиться с задачей в лучшем виде.

  1. Если грибы были собраны правильно, много времени чистка не займет. Останется только перебрать грибную массу, удалив при наличии порченые или червивые экземпляры.
  2. Собирая опята второпях, зачастую остаются на ножках части грибницы, которые нужно срезать.
  3. Определенные виды опят имеют чешуйки на шляпках, которые желательно поскоблить ножом или обтереть салфетками.
  4. Как правило, опята не требуют особого подхода при чистке, и их переработка в большинстве своем будет зависеть от дальнейшего предназначения. Например, для заморозки отбирают самые чистые опята без песка и мусора и по возможности их не моют, а просто вытирают бумажным полотенцем. Грибную массу с частичками земли и другими загрязнениями лучше сполоснуть в воде и дать стечь.

Как варить свежие опята?

Переработать опята предпочтительно в первые сутки после сбора. Хранить их в свежем виде допускается не более двух дней. Перед засолкой, маринованием или добавлением в блюда лесные грибы предварительно отваривают.

  1. Перебирают и промывают грибную массу, оставляют в дуршлаге для стекания.
  2. Кипятят воду, добавив в нее столовую ложку соли на два литра жидкости.
  3. Закладывают подготовленные грибы, дают содержимому кастрюли повторно закипеть, снимая пену.
  4. Сколько времени варить опята зависит от размера и степени зрелости грибов. Признаком готовности будет опускание грибной массы на дно. Как правило, варка занимает около получаса.

Что можно сделать с опятами?

Разобравшись, что делать с опятами после сбора, и правильно их подготовив к дальнейшему приготовлению, можно приступать к исполнению рецептов для получения вкусных закусок или самостоятельных блюд. Популярные версии применения опят в кулинарии или заготовки их впрок помогут использовать продукт максимально результативно.

  1. Рецепты с опятами могут предполагать их варку с последующим тушением, жаркой, а также заготовку впрок в виде маринованной закуски или икры.
  2. Многокомпонентные блюда с опятами, где грибы сочетаются с овощами или мясом, порадуют великолепными вкусовыми и питательными характеристиками, потрясающим насыщенным ароматом.
  3. Рецепты с опятами на зиму включают длительную стерилизацию заготовок, которые впоследствии можно герметично укупоривать. Без стерилизации сосуды можно хранить в холоде под неплотно прикрытыми крышками.
Как мариновать опята на зиму с уксусом?

Отравление грибами — ГБУЗ ГП 13 г. Краснодара МЗ КК

Отравление грибами

Вопрос о съедобности различных грибов до сих пор вызывает споры. Во многих странах Европы, в Южной Америке вообще не собирают дикорастущие грибы. В ряде мусульманских стран собирать и есть грибы считается тяжким грехом. Употребление грибов в России – это древняя национальная традиция. Встреча с грибом всегда сопряжена с опасностью — съев его, можно получить ни с чем не сравнимое гастрономическое удовольствие или же отравиться.

Ежегодно в России, в том числе на территории края, регистрируются многочисленные случаи острых отравлений ядовитыми грибами, пик которых приходится на конец лета и на период «бабьего лета». Отравления грибами относятся к биологическим отравлениям и протекают намного тяжелее других пищевых отравлений.

Острые отравления грибами могут вызвать:

· собственно ядовитые грибы — бледная поганка, мухоморы, ложные 
опята, ложные дождевики;

· условно съедобные грибы, выделяющие при разламывании млечный сок  (дождевики, чернильный гриб, или навозник, сморчки, строчки и т.д.) в результате неумелой или неправильной кулинарной обработки;

· съедобные грибы, получившие название «мутанты», — накопившие в мицелии ядовитые вещества (пестициды, гербициды, соли тяжелых металлов, содержащиеся в выхлопных газах автомобилей, нефтепродукты и др.), продукты разложения белков в старых плодовых телах, а также — продукты жизнедеятельности прижившихся насекомых и червей и приобретающие качественно новые свойства, в том числе вредные для человека.

Отравления грибами обычно бывают случайными (пострадавшие уверены, что употребляли съедобные грибы) и часто носят семейный характер. Симптомы отравления грибами развиваются в диапазоне от 30 минут до 24 часов. Тяжелее всего переносят отравление грибами дети, и процент смертельных случаев здесь наиболее высокий. При отравлении грибами в первую очередь поражается желудочно-кишечный тракт, что клинически проявляется симптомами острого гастроэнтерита и приводит к более или менее острому обезвоживанию организма.

Известно четыре типа грибных отравлений.

К I типу относятся отравления бледной поганкой. Это самый ядовитый гриб. При отравлении им отмечается от 35 до 90% смертельных исходов. Его часто путают с шампиньоном, иногда с зелёнками и даже сыроежками. Содержащиеся в бледной поганке яды фаллоидин и аманитин не разрушаются высокой температурой и кислотами, поэтому варка, маринование и другие виды кулинарной обработки не освобождают грибы от токсических свойств. Достаточно 30 мг яда, чтобы убить взрослого человека. Первые признаки отравления бледной поганкой появляются довольно поздно — через 8-18 часов, что характерно для этого отравления. Возникают головная боль, головокружение, нарушение нормального зрения, одновременно развивается бурно протекающий холероподобный гастроэнтерит с неукротимой рвотой и сильными болями в животе. Наступает обезвоживание организма: больной ощущает сильную жажду, нарастает слабость, наблюдается потеря голоса, возникают судороги, особенно в икроножных мышцах. Отмечается сгущение крови и уменьшение выделяемой мочи вплоть до полного прекращения мочеотделения. Появляется обильный пот, холодеют конечности, кожа их приобретает синюшный цвет, пульс становится слабым, температура падает до 36-35°C. Через несколько часов приступы исчезают часа на 2, но затем вновь возобновляются, больной слабеет, впадает в забытьё.

На 2-3-й день понос и рвота становятся реже. В это время появляются симптомы печёночной и почечной недостаточности. Печень увеличивается и становится болезненной, может наблюдаться желтуха. Развивается коматозное состояние, для которого характерно максимальное расширение зрачков, желтушность склер, падение артериального давления.

Ко II типу относятся отравления мухоморами. Мухомор всем известен своей красной с белыми крапинками шляпкой, но иногда шляпка имеет другую окраску, и по её цвету мухомор называют порфировым, пантерным, жёлтым и белым. Отравления обычно бывают, когда мухоморы принимают за шампиньоны или опята. В связи с наличием высокой ножки и яркой окраски мухоморы видны издалека и привлекают к себе внимание, особенно детей, поэтому маленькие дети, оставленные без присмотра на лесных полянах, могут взять их в рот. Ядовитыми веществами мухомора являются мускарин, микоатропин, мушиный яд.

Картина отравления мухомором развивается через полчаса или 2-6 часов после его употребления. Пострадавшего беспокоят тошнота, рвота, понос, боли в животе, но не в такой сильной степени, как при отравлении бледной поганкой. Появляется обильное потоотделение, иногда слюнотечение, сужение зрачков. В более тяжёлых случаях отравления вследствие поражения центральной нервной системы появляется выраженная одышка, повышается отделение бронхиального секрета, урежается пульс, падает артериальное давление. Возбуждение сменяется состоянием подавленности, развиваются головокружение, спутанность сознания, бред, галлюцинации и коматозное состояние. При позднем проявлении отравление носит бурный и внезапный характер, оно выражается чувством сжатия глотки, приступом страха, жаждой, болями в животе и другими желудочно-кишенчыми явлениями, которые как бы отступают на задний план, уступая ведущее место в клинической картине состоянию, похожему на опьянение. Отмечаются бред, припадки бешенства. Появляются клонические судороги и другие симптомы, напоминающие отравления белладонной. Отравившийся засыпает, а, проснувшись, через некоторое время чувствует себя лучше. Полное выздоровление наступает через 2-3 дня. Смертность отмечается в 2-3% случаев и наступает через 6-12 часов при больших количествах съеденного гриба. Чаще всего гибнут старики и дети, а также лица, страдающие болезнями сердца и почек.

К III типу относится отравление строчками. Строчки появляются в лесу в апреле — мае, как только сойдёт снег. Токсическим началом строчков является гельвелловая кислота, которая содержится в грибах в количестве 0,2-0,4%. Однако содержание яда в грибах в зависимости от погоды, времени сбора может колебаться; иногда его бывает недостаточно, чтобы вызвать отравление. Гельвелловая кислота обладает гемолитическим свойством. Кроме того, в строчках есть и другое отксическое вещество, обладающее нейротропными свойствами.

Первые признаки отравления строчками появляются через 6-10 часов. Основные симптомы отравления — плохое самочувствие, боль в животе, тошнота, переходящая в неукротимую рвоту. Иногда отмечается жидкий учащенный стул, одновременно появляется сильная головная боль. В ряде случаев отравление ограничивается этими явлениями и человек выздоравливает. У детей бывает резко выражены явления поражения центральной нервной системы (бред, клинические судороги, расширение зрачков). В тяжёлых случаях со следующего дня развивается различной степени желтуха. Печень увеличивается, становится болезненной. Могут развиваться явления гемолиза, и при разрушении не менее 20% всех эритроцитов у отравленного возникает анемия, гемоглобинурия, моча становится красно-бурой. Смерть наступает при явлениях сердечно-сосудистой недостаточности на 3-4-й день заболевания. Частота смертельных исходов достигает 30%, особенно чувствительны к яду дети. Прогноз неопределённый, так как лёгкие в начале отравления симптомы могут в дальнейшем принять тяжёлое течение. В целях профилактики отравления предварительное 15-минутное кипячение строчков вызывает переход гельвелловой кислоты в отвар. Отвар удаляют, грибы отжимают, повторно промывают, а затем жарят. Не рекомендуется есть их более 200 г.

К IV типу относятся отравления ложными опятами и другими грибами, содержащими жгучий млечный сок (волнушки, сыроежки, свинушки, чернушки и пр.). Картина отравления примерно одинаковая. Ложный опёнок отличается от настоящего яркой оранжево-жёлтой шляпкой и более тонкими пеньками. После их употребления отравление наступает через 1-6 часов и выражается в слабости, тошноте, рвоте, болях в животе, поносе, т.е. развивается картина сильного желудочно-кишечного расстройства, которое продолжается 1-2 суток, а затем наступает выздоровление. Случаев смертельного отравления этими грибами не бывает. Ядовитое начало его мало изучено.

Принципы оказания неотложной помощи

Острые отравления грибами требуют неотложной помощи. При этом большое значение имеет проведение общих мероприятий. Выведение яда из организма достигается рвотой, которая необходима при наличии в желудке крупных кусков ядовитых грибов. В домашних условиях вызвать рвоту можно приёмом 5-6-ти стаканов теплой подсоленной воды с последующим надавливанием пальцем на корень языка. При полубессознательном или бессознательном состоянии пострадавшего вызывать рвоту нельзя, так как может произойти закупорка дыхательных путей рвотными массами. После очищения желудка полезно выпить активированного угля из расчета одна таблетка на 10 килограмм веса.

Растворимость и всасывание яда можно уменьшить с помощью обволакивающих средств. С этой целью пользуются овсяными отварами, белковой водой (2 яичных белка размешать в 0,5 л воды и давать пить глотками), молоком. Следует уложить пострадавшего в постель, приложить к ногам грелку и обильно поить водой или крепким чаем. Противопоказанием к водной нагрузке является острая сердечно-сосудистая или почечная недостаточность (анурия). После этих процедур больного необходимо скорее доставить в лечебное учреждение.

В условиях стационара потерю жидкости возмещают внутривенным капельным введением растворов, проводят гемодиализ, корригируют свертываемость крови. При возбуждении или судорогах вводят противосудорожные препараты, при коматозном состоянии и параличе дыхательного центра проводят интубацию и осуществляют искусственную вентиляцию легких.

Правила профилактики грибных отравлений

1. Собирать надо только те грибы, которые Вы хорошо знаете. Незнакомые и сомнительные грибы брать не следует.

2. Не следует собирать старые, переросшие грибы, хотя они и не червивые.

3. Грибы — продукт скоропортящийся, и долго хранить их нельзя, особенно в тепле. Остерегайтесь повторного использования и разогревания грибных блюд, особенно с картофелем. Отравления часто происходят от испортившейся или неправильно приготовленной грибной пищи, а не от ядовитых грибов.

4. Не храните солёные грибы в оцинкованной, алюминиевой и глиняной посуде.

5. Ни в коем случае нельзя пробовать на вкус неизвестный гриб. Нельзя есть грибы сырыми. В грибную пору не оставляйте детей одних в лесу или в парке. Предупредите их, чтобы они не трогали грибов без Вашего ведома.

6. Все собранные пластинчатые грибы — млечники (волнушки, грузди, валуи и др.) перед засолом необходимо вымочить или отварить (иногда и то, и другое), чтобы удалить горький и едкий вкус. Эти грибы не следует жарить и варить.

7. Собирая шампиньоны, обязательно смотрите на цвет пластинок, которые должны быть розовыми и даже чёрными (у старых экземпляров). У двойника шампиньона — бледной поганки — пластинки белые.

8. Пластинчатые грибы. Похожие на сыроежки, рядовики, но имеющие на нижней части ножки клубневидное утолщение, как у бледной поганки и мухомора, брать ни в коем случае нельзя.

9. При сборе опёнков никогда не берите похожих на них грибов с ярко окрашенной блестящей шляпкой.

10. Для приготовления грибного супа или поджарки следует брать только явно съедобные грибы, без червоточин и признаков гниения, тщательно промытые; грибы хорошо отваривают или прожаривают.

И наконец последний совет — не злоупотребляйте пищей из грибов. Не забывайте, что грибы — главным образом белковый продукт, что основную часть их белков составляет грибная клетчатка, которая или переваривается с трудом и в малой степени, или вообще практически не переваривается (например, лисички и опята). Не ешьте много грибов на ночь, при обработке сырых грибов старайтесь их помельче нарезать, измельчить, побольше используйте грибной порошок из высушенных грибов. Грибы являются трудно перевариваемым в кишечнике продуктом. Не рекомендуется есть грибы беременным и кормящим женщинам, они противопоказаны детям до 8 лет (независимо от способа и времени приготовления). Спиртные напитки категорически запрещаются, т.к. они облегчают распространение яда в организме.

Статья: Отравления грибами.

На сегодня известно около 70 тысяч видов всех грибов на земле. Каждый год, по данным зарубежных ученых, специалисты открывают и описывают по тысяче новых видов. Поэтому общее число видов грибов предположительно доходит до 100-300 тысяч, а, по мнению некоторых микологов – до 1,5 миллиона. Однако для любителей тихой охоты подходят только крупные, по крайней мере, хорошо различимые глазом человека, грибы. И еще надо, чтобы эти грибы были съедобными. А таких грибов всего около 300-400 видов. Для нашего народа привычно пользоваться лесными грибами и ягодами. Ежегодное начало массового грибного сезона (июль-август) знаменует начало массовых грибных отравлений. Симптомы отравления грибами развиваются через 1-2 часа – 18-24 часа. Более благоприятным бывает прогноз при отравлениях, симптомы которых проявляются в первые часы. Наиболее частые проявления грибных отравлений: боли в животе, тошнота, рвота, понос. Алкалоиды ядовитых грибов оказывают действие на желудочно-кишечный тракт, печень и центральную нервную систему. Часто поражаются почки. Всегда страдает сердечно-сосудистая система.

Действия больного до прихода врача практически сводятся к очищению организма от ядовитой пищи. С одной стороны, это промывание и очищение кишечника с помощью слабительного и клизмы. С другой – это очищение желудка с помощью искусственно вызванной рвоты. Нужно выпить много жидкости: рекомендуют 4-5 стаканов холодной воды с содой (треть чайной ложки на стакан воды), крепкий холодный чай, кофе или молоко. Алкогольные напитки, которые увеличивают всасываемость веществ стенками желудка, то есть усиливают усвоение ядов, запрещены. Полезно принять 2 таблетки активированного угля для успокоения бурлящего живота и адсорб­ции вредных веществ.

Локальные вторичные желудочно-кишечные отравления могут быть вызваны и другими причинами: неправильным сбором, хранением и приготовлением грибов. Млечники, некоторые сыроежки, волнушки и другие условно съедобные грибы, содержащие едкие и раздражающие вещества – причина слабых отравлений в тех случаях, если грибы не доварены и вредные для органов пищеварения вещества в них сохранились. Сбор грибов в местах экологического загрязнения, вблизи удобряемых полей, свалок, захоронений, автомобильных дорог, заводов – еще одна причина возможных отравлений. Грибы, растущие в таких местах, могут накапливать тяжелые металлы и пестициды. Не следует собирать червивые и перестоявшие, старые грибы («перестарки»).

Старые грибы содержат вредные продукты грибного обмена веществ (в том числе мочевину). Неправильное хранение – длительное, более суток в теплом месте – приводит к раскисанию грибов и разложению содержащихся в них белков с образованием вредных для органов пищеварения веществ. Особенно это относится к мягким трубчатым грибам (маслята, моховики). У некоторых людей бывает непереносимость грибной пищи вообще или повышенная чувствительность к определенным видам. Съедобные грибы могут вызвать у них послабление желудочно-кишечного тракта (серно-желтый трутовик, иногда опята осенние) или сыпь на коже (опята осенние). Следует учитывать возраст и состояние здоровья человека. Дети переносят отравление даже слабо ядовиты­ми грибами гораздо тяжелее взрослого. Для людей с хро­ническими заболеваниями желудка и кишечника грибы – провоцирующая пища и легко вызывает локальные отравления. Профилактика грибных отравлений состоит из про­стых и понятных правил собирания и употребления. Они основаны на знании съедобных и ядовитых грибов, внимательности и аккуратности. Азарт грибной охоты, излишняя самонадеянность не должны мешать разумному подходу к этому вопросу.

1. Собирайте для еды только знакомые грибы. Сомнительные либо выбрасывайте сразу, либо откладывайте для определения в отдельный пакет, не оставляйте их в общей корзине. Определить видовую принадлежность грибов лучше на месте сбора. Дома многие из них будут иметь совсем другой внешний вид, и опознать их будет еще труднее.

2. Будьте внимательны при собирании: иногда ядовитые грибы растут вперемежку со съедобными (например, ложные опята среди настоящих).

3.  Не собирайте старые и червивые, грибы у автомобильных дорог, заводов и в других экологически загрязненных местах.

4. Не храните сырые грибы в теплом месте, а в холодильнике – не более суток. Не употребляйте в пищу залежалые грибы. Вареные грибы можно хранить в холодильнике 1-3 дня в стеклянной или эмалированной посуде.

Существует множество предрассудков, как отличить ядовитые грибы от съедобных. Говорят, например, что у ядовитых неприятный запах и что их не едят насекомые (то есть они не бывают червивыми) или что луковица темнеет при варке с ядовитыми грибами и т.д. и т.п. И все это удивительно живуче: не только умудренные годами, но и молодые люди повторяют такие ошибки. Ничему этому не верьте. Бледная поганка – очень вкусный гриб с приятным грибным запахом, и в то же время – один из самых ядовитых грибов в природе. Есть и такие грибы, о съедобности которых мнения специалистов различны. Одни и те же грибы в разных кни­гах причисляются к съедобным или к условно съедобным. Лучше отваривать все подобные грибы и отвар сливать. Медленно и неохотно усваиваются грибниками новые сведения о ядовитости некоторых грибов. Прежде всего, это касается ядовитости строчка обыкновенного и свинушки тонкой. Тем более что отравления строчком происходят не всегда и не везде, а от свинушки вообще нет видимых сразу последствий. Тем не менее, признавая науку, нужно относиться к этому как к научно установленному факту и исключить эти грибы из употребления.

Помните! Грибы лучше и безопасней покупать в магазинах. Там продают грибы, выращенные промышленным способом, на которые дается гарантия безопасности. Нельзя покупать грибы у случайных лиц, а тем более собирать их самому, не имея на то достаточно опыта.

 

 Материал взят из : ГБУЗ «Центр медицинской профилактики» министерства здравоохранения Краснодарского края

 

Маринованные Опята коды ТН ВЭД (2020): 2001905000, 2106909809, 2001

Консервы грибные «Премиум» в ассортименте: опята маринованные; маслята маринованные; грузди маринованные; грибочки ассорти маринованные, шампиньоны резаные маринованные; шампиньоны целые маринованные, лесовики маринованные 2001905000
Консервы стерилизованные: шампиньоны маринованные, опята маринованные, маслята маринованные, грузди маринованные, ассорти маринованные, упакованные в стеклянные и жестяные банки объемом от 300 миллилитров до 600 миллилитро 2001905000
Консервы грибные «Премиум» в ассортименте: опята маринованные, маслята маринованные, грузди маринованные, грибочки ассорти маринованные, шампиньоны резаные маринованные, шампиньоны целые маринованные, лесовики маринованные 2001905000
Грибы маринованные с добавлением уксуса и уксусной кислоты: опята, маслята, грузди, шампиньоны, ассорти из маслят, вешенок, опят, груздей, 2001905000
Грибы маринованные: «Шампиньоны маринованные», «Опята маринованные», «Маслята маринованные», «Грузди маринованные», «Ассорти маринованные» 2001905000
Консервы. Грибы маринованные: вешенки обыкновенные, опята осенние. 2001905000
Салаты и винегреты: Салат Витаминный; Салат сырный с чесноком; Винегрет овощной; Салат грибной; Капуста по-грузински; Салат Свекла сыром и чесноком; Салат из свеклы с черносливом и грецким орехом; Опята маринованные с лук 2106909809
Консервы грибные в ассортименте: Опята маринованные, Грузди маринованные, Грибное ассорти маринованное. 2001905000
Консервы стерилизованные: шампиньоны маринованные, опята маринованные, маслята маринованные, грузди маринованные, ассорти грибное маринованное. 2001
Грибы маринованные консервированные т.з. «Чудесный лес»: Опята маринованные, в стеклянных банках. 2003909000
Грибы консервированные с добавлением уксуса: опята (маринованные) 2001905000
Грибы консервированные и маринованные, без добавления уксуса и уксусной кислоты с маркировкой «EXCELLENT», опята и грузди натуральные, шампиньоны, ассорти из опят, груздей и вешенок, упакованные в жестяные банки массой от 2003103000
Грибы: маринованные — вешенки, шампиньоны, грузди, волнушки, белянки, рыжики, опята, подгруздки, сыроежки, лисички, маслята; соленые — шампиньоны, грузди, волнушки, белянки, рыжики, подгруздки, сыроежки; солено-отварные — 2001905000
Салаты овощные: Баклажаны по-корейски, Грибы маринованные в ассортименте по-корейски, Грибы-лисички по-корейски, Грибы опята по-корейски, Шампиньоны маринованные по-корейски, Грибы закусочные по-корейски, Капуста с морковь 2001
Консервы грибные: ассорти из маринованных грибов (в состав могут входить вешенки, опята, грузди, шампиньоны или маслята в различных весовых пропорциях), упаковка: стеклянные банки 580 мл 2001905000
САЛАТЫ ОВОЩНЫЕ МАРИНОВАННЫЕ ПО-КОРЕЙСКИ: «Кукурузные початки в маринаде», «Фантазия», «Ассорти грибное», «Весна», «Вешенка по-корейски», «Вешенка с капустой», «Коралловый гриб по-корейски», «Опята по-корейски», «Черный дре 200190970
Грибы маринованные отборные: Грибное лукошко, Грузди, Маслята, Опята, упакованные в стеклянные, жестяные банки объемом до 5 литров 2001905000
Консервы грибные торговой марки «Кормилица»: шампиньоны целые, ассорти грибное, опята, грузди, маслята маринованные в стеклянных и жестяных банках объемом от 200 мл до 3100 мл. 2003102000
Грибы маринованные: вешенка обыкновенная, опята, ассорти (опята и вешенки), шампиньоны 2001905000
Грибы консервированные и маринованные без добавления уксуса и уксусной кислоты: опята натуральные и грузди натуральные, шампиньоны, ассорти из опят, груздей и вешенок 2001905000
Консервы грибные: Опята маринованные отборные в стеклянных и жестяных банках объемом до 5л 2001905000
ГРИБЫ СОЛЕНЫЕ И МАРИНОВАННЫЕ. ГРИБЫ МАРИНОВАННЫЕ: ПОДОСИНОВИКИ, ОПЯТА, МАСЛЯТА, МОХОВИКИ; ГРИБЫ СОЛЕНЫЕ: БЕЛЫЕ, ВОЛНУШКИ, ЛИСИЧКИ, РЫЖИКИ, ГРУЗДИ (БЕЛЫЕ, ЧЕРНЫЕ, РЯДОВКИ СЕРЫЕ. 2001905000
Консервы из грибов: маслята (suillus) маринованные, опята (nameko) маринованные, грузди (shiitake) маринованные, шампиньоны маринованные, ассорти грибное маринованное 2001905000
Шампиньоны маринованные резанные, Шампиньоны маринованные целые, Опята маринованные, Опята отборные маринованные, Грузди маринованные, Грузди отборные маринованные, Маслята маринованные, Маслята отборные маринованные, Гриб 2001905000
Консервы овощные: грибы опята (намеко) консервированные с добавлением уксуса (маринованные), томаты маринованные, томаты «Черри» маринованные, упакованные в стеклянные банки по 314, 580, 720, 1415 миллилитров 2001909709

Подмосковные грибы отстают от календаря, строчки сменились опятами

+ A —

Наблюдения обозревателя «МК»

Затянувшаяся прохладная погода повлияла на ассортимент и количество грибов в подмосковных лесах. Сейчас грибов примерно столько сколько бывает в третьей декаде мая, а видов их существенно меньше, чем обычно бывает в начале лета. О последних «грибных» новостях рассказывает постоянный обозреватель «МК».

Обильный урожай строчков уже собран. Ему на смену пришли мощной волной летние опята. В прошедшие субботу и среду я специально посетил в хорошо знакомом лесу места, в которых в прежние годы собирал летние опята. Сначала неоднократно на основании подгнивших стволов деревьев находил небольшие пучки летних опят.

Фото: Олег Савельев

Потом стали встречаться уже в больших количествах на почве и на высохших деревьях.

Фото: Олег Савельев

Кроме того было много мелких летних опят ещё не пригодных для сбора. Скорее всего, в предстоящие выходные этих грибов будет так же много. Других новых видов съедобных грибов кроме нескольких шампиньонов найти не удавалось.

Фото: Олег Савельев

Всего набрал летних опят столько сколько мог унести и потом без чрезвычайных усилий приготовить.

Фото: Олег Савельев Фото: Олег Савельев

Стоит отметить особенности сбора летних опят, которые еще часто называют говорушками или варушками. В средней полосе летние опята растут почти всегда, кроме сильной засухи, непрерывно с конца мая до начала ноября. Обычно в конце грибной прогулки я добираю, если нет других более ценных и массивных видов грибов, летние опята на знакомых местах до полной корзины. Заодно замечаю пеньки с мелкими экземплярами этих грибов величиной с булавочную головку. Через несколько дней эта мелочь дорастет и будет вполне пригодна для сбора. Летние опята, безусловно, очень вкусные грибы. Между грибниками идёт бесконечный спор: что вкуснее — жаренные летние или осенние опята?

Диаметр шляпки у взрослого гриба обычно 3-6 см, ножка примерно такой же длинны и не толще половины сантиметра. Есть у летних опят и не очень приятные особенности. Грибы эти мелкие и в теплое летнее время часто бывают сильно червивыми. Их очистка и приготовления требует много времени и терпения. К тому же летние опята сильно увариваются и ужариваются. Поэтому набрать их в не очень большом количестве и сразу приготовить ещё не так трудно, а вот заготавливать впрок на зиму уже довольно-таки утомительное занятие. Лучше всего сушить наиболее крупные шляпки летних опят. В сушеном виде эти грибы хорошо хранятся несколько лет плотно закрытых от пищевой моли и прочих насекомых-вредителей стеклянных банках. После нескольких часов предварительного размачивания в воде, а еще лучше — в молоке, летние опята можно жарить, как и свежие грибы.

Распознать летние опята и не перепутать их с другими видами несъедобных ложных опят нетрудно. У летних опят преобладают желтый, бежевый и коричневый цвета. Шляпка или вся бежевого цвета, но чаще на бежевом фоне почти по всей шляпке желтый круг. Старые грибы часто становятся бурыми или темно-коричневыми. У наиболее распространенного вида уже тоже появившихся ложных опят — слабо ядовитых серно-желтых — изнанка шляпки имеет зеленоватые тона. Но проще всего распознать летние опята можно по запаху. У них неповторимый для других видов грибов, легко запоминающийся приятный душистый аромат. Ложные опята пахнут неприятно – «псиной» — или вовсе не имеют запаха.

На мой вкус летние опята особенно хороши в жареном виде. Суп из них не так вкусен, как из белых или березовиков и осинников, хотя многие грибники его хвалят. Встречается мнение, что ножки у взрослых летних опят лучше отрезать и не употреблять в пищу. Конечно, они несколько жестковаты, но, на мой вкус, в пищу вполне пригодны.

Чаще всего растут летние опята на пнях, лежачих стволах и на корнях сухих лиственных деревьев. Их можно срезать острым ножиком или выщипывать целыми гроздьями. При чистке кончик ножки я отрезаю и разрезаю грибок пополам вдоль от ножки вместе со шляпкой. Потом грибы замачиваю в холодной воде, где они отмокают от мелкого мусора. Зачерпываю грибы дуршлагом, даю воде стечь и высыпаю на сковороду, где на ароматном подсолнечном масле уже поджарен до золотистого цвета репчатый лук. Жарятся грибы 15-20 минут. Если грибов мало, имеет смысл доложить в сковороду сырой картофель.

Собираясь в ближайшее время в лес следует иметь в виду, что заметно активизировались комары. Но продолжают радовать цветущие ландыши и особенно купальницы.

Фото: Олег Савельев

Весенний дебют летних опят в Подмосковье

+ A —

Извечный спор: что вкуснее — жареные летние или осенние опята

В апреле этого года в московском регионе наступление весны в связи с прохладной погодой и таяньем обильного зимнего снега несколько задерживалось. Однако теплая и сухая погода первой половины мая приблизила установление климата, скорее характерного для начала лета. Летнее тепло сказалось и на состоянии растительности в подмосковных лесах, которое сейчас примерно такое, какое обычно бывает в конце третьей декады мая. Количество и ассортимент лесных грибов несколько хуже, чем обычно бывало в это время в прошлые годы. С подробностями — наш корреспондент.

Тем не менее в прошедший вторник довольно успешно посетил в хорошо знакомом лесу грибные места. Редко попадались подросшие строчки.

Чаще эти грибы росли не в одиночестве, а небольшими группами.

Всего удалось заполнить строчками половину небольшой корзинки.

Других съедобных грибов, характерных для этого времени года (сморчков, вешенок и серно-желтых трутовиков), отыскать не удалось.

В конце лесной прогулки неожиданно для себя нашел небольшую семейку летних опят.

Времени до отхода последней электрички до почти трехчасового перерыва оставалось мало. Поэтому просмотреть места обычного обитания летних опят в этом лесу не удалось. Но скорее всего, в предстоящие выходные дни можно будет начинать собирать летние опята — грибы, широко распространенные в подмосковных лесах.

Стоит отметить особенности сбора летних опят, которые еще часто называют говорушками или варушками. В средней полосе летние опята растут почти всегда, кроме времени сильной засухи, непрерывно с конца мая до начала ноября. Обычно в конце грибной прогулки я добираю, если нет других более ценных и массивных видов грибов, летние опята на знакомых местах до полной корзины. Заодно замечаю пеньки с мелкими экземплярами этих грибов, величиной с булавочную головку. Через несколько дней эта мелочь дорастет и будет вполне пригодна для сбора. Летние опята, безусловно, очень вкусные грибы. Между грибниками идет бесконечный спор: что вкуснее — жареные летние или осенние опята?

Диаметр шляпки у взрослого гриба обычно 3–6 см, ножка примерно такой же длинны и не толще половины сантиметра. Есть у летних опят и не очень приятные особенности. Грибы эти мелкие и в теплое летнее время часто бывают сильно червивыми. Их очистка и приготовление требует много времени и терпения. К тому же летние опята сильно увариваются и ужариваются. Поэтому набрать их в не очень большом количестве и сразу приготовить еще не так трудно, а вот заготавливать впрок на зиму уже довольно-таки утомительное занятие. Лучше всего сушить наиболее крупные шляпки летних опят. В сушеном виде эти грибы хорошо хранятся несколько лет в плотно закрытых от пищевой моли и прочих насекомых-вредителей стеклянных банках. После нескольких часов предварительного размачивания в воде, а еще лучше — в молоке летние опята можно жарить, как и свежие грибы.

Распознать летние опята и не перепутать их с другими видами несъедобных ложных опят нетрудно. У летних опят преобладают желтый, бежевый и коричневый цвета. Шляпка или вся бежевого цвета, но чаще на бежевом фоне почти по всей шляпке желтый круг. Старые грибы часто становятся бурыми или темно-коричневыми. У наиболее распространенного вида уже тоже появившихся ложных опят — слабоядовитых серно-желтых — изнанка шляпки имеет зеленоватые тона. Но проще всего распознать летние опята по запаху — у них неповторимый для других видов грибов, легко запоминающийся приятный запах. Ложные опята пахнут неприятно — псиной — или вовсе не имеют запаха.

На мой вкус, летние опята особенно хороши в жареном виде. Суп из них не так вкусен, как из белых или подберезовиков и подосиновиков, хотя многие грибники его хвалят. Встречается мнение, что ножки у взрослых летних опят лучше отрезать и не употреблять в пищу. Конечно, они несколько жестковаты, но, на мой вкус, в пищу вполне пригодны.

Чаще всего растут летние опята на пнях, лежачих стволах и на корнях сухих лиственных деревьев. Их можно срезать острым ножиком или выщипывать целыми гроздьями. При чистке кончик ножки я отрезаю и разрезаю грибок пополам вдоль ножки вместе со шляпкой. Потом грибы замачиваю в холодной воде, где они отмокают от мелкого мусора. Зачерпываю грибы дуршлагом, даю воде стечь и высыпаю на сковороду, где на ароматном подсолнечном масле уже поджарен до золотистого цвета репчатый лук. Жарятся грибы 15–20 минут. Если грибов мало, имеет смысл доложить в сковороду сырой картофель.

Собираясь в ближайшее время в лес, следует иметь в виду, что с потеплением заметно активизировались комары. Поэтому, собираясь на лесную прогулку, следует одеваться в плотную непрокусываемую одежду и запасаться различными антикомариными репеллентами в виде лосьонов, мазей и аэрозолей. Необходимо предварительно ознакомиться с инструкцией по их применению. Некоторые из этих средств наносятся только на одежду и могут навредить кожному покрову и особенно слизистым оболочкам.

В лесу сейчас и просто прогуляться довольно-таки приятно. Радует глаз изумрудного цвета листва и травы, щебечут разнообразные птицы. Во многих местах землю покрывает кислица обыкновенная (заячья капуста) с мелкими белыми цветами. Пока еще нежная молодая кислица имеет щавельный вкус и хорошо утоляет жажду.

Раньше обычного зацвел довольно редкий для наших лесов барвинок. В западноукраинских и европейских лесах этот цветок называют еще колдовской фиалкой. И связывают с ним много легенд и преданий.

Уже начинают зацветать ландыши и купальницы.

Все эти растения обладают различными лечебными свойствами и применяются в народной и частично в традиционной медицине.

Что делать с опятами после сбора

Опята ― это вкусный источник полноценных белков, цинка, железа, фосфора и витамина С. Употребление этих грибов помогает организму преодолевать вирусные заболевания, и наполнятся жизненной силой. Но многие хозяйки избегают этот лесной продукт, ссылаясь на сложность очистки и приготовления опят. На самом деле тут нет ничего сложного.

Как очистить опята

Опята ― скоропортящийся продукт, поэтому его очистку нужно начинать сразу после возвращения из лесу, ну или с магазина. Грибы очень хрупкие и небольшие, но процесс очистки не займет много сил:

  • Переберите урожай. Все гнилые, трухлявые и поврежденные насекомыми экземпляры без зазрения совести отправляйте в мусорное ведро.
  • Удалите органический «мусор» ― веточки, листики, землю.
  • Далее нужно определить, какой обработке будут подвергаться грибы. Если вы хотите их сушить, срежьте нижний сегмент ножки и удалите пленку под шапочкой. Если грибы требуются в свежем виде, дополнительно их стоит замочить в воде (максимум 1 час), а потом очистить пленку (юбочку).

Как приготовить отварные опята

После очистки можно приступать к термической обработке грибов:

  • Возьмите эмалированную кастрюлю и вскипятите в ней подсоленную воду.
  • Отправьте грибы в кипящую воду на 10 минут, при этом обязательно снимайте пенку.
  • Слейте грибной отвар и залейте грибы чистой водой.
  • После закипания проварите грибы 30-40 минут.
  • Когда опята полностью приготовятся, они осядут на дно посуды.
  • Откиньте грибы на дуршлаг и промойте их водой. Это позволит смыть лишнюю слизь.



Как приготовить жареные опята

Поджаренные опята с луком, наверное, самый вкусный вариант их приготовления:

  • Предварительно отварите опята.
  • Пока они готовятся, поджарьте лук, нарезанный кольцами, на сливочном масле.
  • Добавьте опята к луку, посолите их, и готовьте блюдо около 20 минут.
  • При подаче на стол, посыпьте жареные опята измельченным зеленым луком или базиликом.



Как приготовить засоленные опята

Засоленные опята можно использовать для приготовления салатов и закусок.

  • Отварите грибы, и отделите ножки от шляпок.
  • Если грибы крупные, разрежьте их надвое.
  • Далее добавьте к грибам порубленный чеснок, полукольца лука и зелень (укроп или петрушку).
  • По желанию можно добавить лавровый лист, перец и другие специи.
  • Теперь добавьте соль: на каждый килограмм грибов ― 2 ст. л. соли.
  • Все ингредиенты перемешайте, выложите в эмалированную емкость и поставьте под гнет на 5 суток.
  • По истечении этого времени, уложите опята в стерилизованную банку и поставьте в холодильник.
  • Через 20 дней грибы будут готовы.


Как приготовить маринованные опята

Домашние опята в маринаде намного вкуснее их магазинного аналога.

  • Отварите грибы.
  • Второй грибной бульон не выливайте и процедите.
  • Приготовьте маринад: 500 мг воды; по 1 ст. л. сахара и соли; набор специй (лавровый лист, гвоздика, кардамон, душистый перец).
  • Все компоненты для маринада отправьте в грибной отвар, после его закипания добавляет 1 ст. л. уксуса.
  • Кипящим отваром залейте подготовленные грибы.
  • Через 2-3 часа опята будут готовы.


Приготовление опят не является трудоемким кулинарным процессом. Но блюда с их «участием» всегда украсят торжественный стол или ужин в кругу семьи.

Однако не каждой хозяйке известно, что замораживанию подлежат не только свежие , но и те, что прошли некую обработку. Обо всех секретах правильной сырых, а также прошедших разнообразную обработку в домашних условиях мы и расскажем в данном обзоре.

Подготовка грибов

Если вы собираете самостоятельно, то очищать их от земляного кома, различного сора и мелких насекомых желательно сразу же, в процессе сбора. Дома необходимо перебрать и тщательно очистить от листочков и налипшей грязи. Затем отсортируйте грибочки по размеру. Мелкие экземпляры замораживайте целиком, а крупные — режьте на несколько частей.

Нужно ли мыть

Опята не стоит мыть только в случае, если вы планируете сохранять их методом сырого замораживания. легко впитывают влагу, которая создает лед, занимая много места в морозильной камере. Лишняя жидкость придает заготовке тяжесть, а грибной вкус становится водянистым.

Если же опенки значительно загрязнены, можете протереть их влажным тканевым полотенцем, а после — просушить. На худой конец, можно ополоснуть грибочки под проточной водой и тщательно высушить на полотняном полотенце. Однако старайтесь все же не слишком мочить опята.

Знаете ли вы? Грибы способны «пробивать» мрамор. В стадии роста внутреннее давление этих удивительных созданий доходит до показателей давления семи атмосфер. Поэтому, как ни странно, но нежный мицелий действительно пробивается сквозь такие твердые поверхности, как асфальт, бетон, мрамор и даже железо.

Способы заморозки

Очищенные опята можно замораживать как в сыром, так и вареном, тушеном или жареном виде. Помимо этого, грибы можно предварительно бланшировать. Выбор способа заморозки зависит от рецептов блюд, которые вы впоследствии планируете готовить. Подберите подходящий конкретно вам вариант!

Сырые

Все действия необходимо воспроизводить в указанном ниже порядке:

  1. Подготовьте плоскую пластиковую подставку или разделочную доску.
  2. Очищенные опята равномерно распределите по поверхности поддона. Укладывать необходимо в один слой, так как плоды могут склеиться и деформироваться.
  3. Морозильную камеру настройте на режим глубокого замораживания.
  4. Затем поддон с плодами нужно ненадолго выдержать в морозилке, пока опята не подмерзнут.
  5. Подмерзшие грибочки пересыпьте в пластиковую тару или полиэтиленовые пакеты и отправьте в морозилку на длительное хранение при температуре -18 ºC.

Предварительная бланшировка

Некоторые хозяйки предпочитают перед замораживанием бланшировать опята, то есть обдают их кипятком. Для этого грибочки промывают под проточной водой. Далее плоды переносят в дуршлаг и обдают их кипятком. Когда влага стечет, а грибочки остынут, их перекладывают на полотенце. Просохшие опенки распределяют по полиэтиленовым пакетикам и переносят в морозильную камеру. Данный способ бланширования является наиболее простым и распространенным.
Существует еще один вариант бланширования, позволяющий наиболее эффективно сохранять питательные вещества :

  1. Приготовьте две большие тары, шумовку, дуршлаг и чистые тканевые полотенца.
  2. В одной емкости приготовьте рассол (20 г соли на 1 л воды), в другую налейте холодную воду (желательно со льдом).
  3. Поместите чистые опята в кипящий рассол. Спустя 2-3 минуты при помощи шумовки достаньте грибы из горячего рассола и тут же перенесите в тару с холодной водой. Подобное охлаждение мгновенно стопорит процесс варки.
  4. Спустя 2-3 минуты откиньте плоды на дуршлаг, после чего просушите на полотенце.
  5. Распределите продукт по полиэтиленовым пакетам.
  6. Отправьте заготовки в морозилку для хранения на зиму.

Повара советуют добавлять в воду, в которой будут обрабатываться грибы, щепотку лимонной кислоты. Этот простой прием позволяет защитить грибочки от потемнения и образования горечи.

Отварные

Многие хозяйки предпочитают замораживать грибочки в отварном виде. Далее вы ознакомитесь с основными нюансами данного метода, а также узнаете, сколько по времени нужно варить опята перед заморозкой.

Пошаговое руководство:

  1. Залейте плоды холодной водой и поставьте вариться на высоком огне.
  2. Когда жидкость закипит, а на поверхности образуется пенка — слейте всю воду.
  3. Грибы снова прополощите, залейте свежей водой, затем поставьте вариться. Или же вскипятите воду, и только потом опустите туда опята.
  4. Варите грибочки еще 40-50 минут. Не забудьте слегка подсолить воду (на 1 л жидкости требуется 10 г поваренной соли).
  5. Откиньте готовые грибочки на дуршлаг, чтобы дать стечь жидкости. При желании можете охладить плоды в холодной воде.
  6. Переложите опята на сухое полотенце.
  7. Когда грибы хорошенько просохнут, приступайте к стандартной заморозке (распределите плоды по пакетам и переложите в морозилку для хранения).

Тушеные

Чтобы опята не потеряли своего пикантного вкуса и аромата, был придуман такой способ заготовки, как тушение. Для такой обработки не требуется даже растительное масло. Пошаговое руководство:

  1. Подготовленные плоды перенесите на разогретую сковороду без жира.
  2. Приправьте плоды поваренной солью, затем плотно накройте крышкой. В таком состоянии грибы скорее пустят свою воду.
  3. Не снимая крышку, тушите грибочки в собственном соку на медленном огне.
  4. Грибы должны тушиться минимум 25-30 минут. Поэтому, если жидкость испарится раньше указанного времени, добавьте немного кипяченой воды.

Тушить грибочки можно и в духовом шкафу. Для этого просто разложите опенки на противень и готовьте их в собственном соку.

Важно! Не пропустите момент полного испарения жидкости! Категорически не допустимо, чтобы опята пригорали — они приобретут горький неприятный привкус.

Жареные

Также можно заморозить жареные опята:

  1. Чистые грибочки перенесите на разогретую сковороду с малым количеством подсолнечного масла.
  2. Жарьте грибы в течение 20 минут, время от времени помешивая. Обжаривать нужно до тех пор, пока из плодов не выпарится вся лишняя жидкость.
  3. Отложите сковороду в сторону, пока грибы полностью не остынут.
  4. Распределите заготовку по пакетам, плотно их заверните. Перенесите пакеты в морозилку для хранения.

Срок хранения

Срок хранения опят, замороженных любым приведенным выше методом, составляет не больше одного года при условии, что температура в морозильной камере будет равна 18 ºC со знаком «минус». Не забудьте приклеить к пакетам стикеры с указанием даты замораживания.

Важно! Никогда не забывайте порционно фасовать грибную заготовку перед хранением. Размороженные грибы нужно тут же использовать, поскольку при вторичной заморозке продукт становится негодным к употреблению в пищу.

Правила разморозки

Зная, как правильно разморозить грибы, вы сохраните качество плодов и текстуру блюда.

Нежелательно помещать опята в духовку или микроволновую печь. Размораживание должно проистекать медленно, при комнатной температуре.
Когда решите размораживать сырые грибочки, переложите их сначала в холодильник. В таком случае опята будут совсем как свежие. После полной разморозки грибочки следует подсушить.

Если опята были сохранены в вареном, тушеном или жареном виде, их также необходимо сначала подвергнуть размораживанию и только потом применять в кулинарии.

Знаете ли вы? Любопытно, что грибы, наряду с , считаются древнейшими обитателями нашей планеты. Грибы старше динозавров, они существовали 400 млн лет назад (задолго до появления динозавров). Даже сохранившиеся до наших времен гигантские значительно измельчали, тогда как грибы сумели приспособиться (многие виды существуют и по сей день).

Как готовить замороженные опята

Подводя итоги, рассмотрим, как лучше готовить замороженные опята. Итак, в супы, а также жареные или тушеные блюда можете класть заготовку сразу же, предварительно не размораживая ее .

Опята ― это вкусный источник полноценных белков, цинка, железа, фосфора и витамина С. Употребление этих грибов помогает организму преодолевать вирусные заболевания, и наполнятся жизненной силой. Но многие хозяйки избегают этот лесной продукт, ссылаясь на сложность очистки и приготовления опят. На самом деле тут нет ничего сложного.

Как очистить опята

Опята ― скоропортящийся продукт, поэтому его очистку нужно начинать сразу после возвращения из лесу, ну или с магазина. Грибы очень хрупкие и небольшие, но процесс очистки не займет много сил:

  • Переберите урожай. Все гнилые, трухлявые и поврежденные насекомыми экземпляры без зазрения совести отправляйте в мусорное ведро.
  • Удалите органический «мусор» ― веточки, листики, землю.
  • Далее нужно определить, какой обработке будут подвергаться грибы. Если вы хотите их сушить, срежьте нижний сегмент ножки и удалите пленку под шапочкой. Если грибы требуются в свежем виде, дополнительно их стоит замочить в воде (максимум 1 час), а потом очистить пленку (юбочку).

Как приготовить отварные опята

После очистки можно приступать к термической обработке грибов:

  • Возьмите эмалированную кастрюлю и вскипятите в ней подсоленную воду.
  • Отправьте грибы в кипящую воду на 10 минут, при этом обязательно снимайте пенку.
  • Слейте грибной отвар и залейте грибы чистой водой.
  • После закипания проварите грибы 30-40 минут.
  • Когда опята полностью приготовятся, они осядут на дно посуды.
  • Откиньте грибы на дуршлаг и промойте их водой. Это позволит смыть лишнюю слизь.

Как приготовить жареные опята

Поджаренные опята с луком, наверное, самый вкусный вариант их приготовления:

  • Предварительно отварите опята.
  • Пока они готовятся, поджарьте лук, нарезанный кольцами, на сливочном масле.
  • Добавьте опята к луку, посолите их, и готовьте блюдо около 20 минут.
  • При подаче на стол, посыпьте жареные опята измельченным зеленым луком или базиликом.

Как приготовить засоленные опята

Засоленные опята можно использовать для приготовления салатов и закусок.

  • Отварите грибы, и отделите ножки от шляпок.
  • Если грибы крупные, разрежьте их надвое.
  • Далее добавьте к грибам порубленный чеснок, полукольца лука и зелень (укроп или петрушку).
  • По желанию можно добавить лавровый лист, перец и другие специи.
  • Теперь добавьте соль: на каждый килограмм грибов ― 2 ст. л. соли.
  • Все ингредиенты перемешайте, выложите в эмалированную емкость и поставьте под гнет на 5 суток.
  • По истечении этого времени, уложите опята в стерилизованную банку и поставьте в холодильник.
  • Через 20 дней грибы будут готовы.


Как приготовить маринованные опята

Домашние опята в маринаде намного вкуснее их магазинного аналога.

  • Отварите грибы.
  • Второй грибной бульон не выливайте и процедите.
  • Приготовьте маринад: 500 мг воды; по 1 ст. л. сахара и соли; набор специй (лавровый лист, гвоздика, кардамон, душистый перец).
  • Все компоненты для маринада отправьте в грибной отвар, после его закипания добавляет 1 ст. л. уксуса.
  • Кипящим отваром залейте подготовленные грибы.
  • Через 2-3 часа опята будут готовы.


Приготовление опят не является трудоемким кулинарным процессом. Но блюда с их «участием» всегда украсят торжественный стол или ужин в кругу семьи.

Являются, пожалуй, одними из наиболее распространенных. Если большинство из «благородных» видов преимущественно растут поодиночке, то опята обычно обнаруживаются целыми «семействами», поэтому собирать их гораздо проще. Учитывая достаточно широкое распространение этих грибов в регионах с различным климатом, а также богатое содержание в них ряда витаминов (витаминов группы В, аскорбиновой кислоты, витамина Е, РР и других), они являются достаточно популярным ингредиентом во многих блюдах.

Несмотря на довольно широкую популярность, у многих все же возникает сомнение относительно того, нужно ли чистить опята. Как и любой другой вид грибов, опята перед использованием для приготовления пищи необходимо надлежащим образом очистить.

Более детально этот процесс рассмотрим ниже.

Как правильно чистить опята

Перед тем, как чистить опята, их желательно рассортировать. Из общего количества собранных грибов желательно удалить старые грибы, а также имеющие признаки поражения червями, насекомыми или гнилью. При наличии признаков поражения только на ножке гриба, ее можно удалить, оставив шляпку. В случае значительного поражения гриба, его лучше выбросить целиком.

Многие грибники при помощи ножа удаляют волнистый «воротничок» с ножки гриба. Фактически, необходимости в этом нет, даже с этим фрагментом вкус конечного блюда не меняется. Поэтому в данном случае необходимость в этой манипуляции продиктована скорее эстетическими мотивами.

После этого нужно выбрать метод, как чистить опята, исходя из того, предназначены эти грибы для засушивания или нет.

В том случае если собранный урожай планируется засушить, проводить замачивание грибов перед чисткой нельзя. Нежелательно их также мыть под проточной водой. Это вызвано тем, что грибы очень сильно впитывают влагу, и если их промыть водой, качественно высушить их будет уже невозможно.

Если грибы планируется сушить, чистить опята можно только сухим методом. В таком случае имеющаяся на грибах грязь, песок, мелкие иголки, фрагменты листьев и прочий мусор удаляется при помощи куска сухой ткани, либо небольшой щеткой с жестким ворсом. Многими с этой целью используется старая зубная щетка.

В том случае, если грибы планируется употребить свежими, либо законсервировать в вареном виде, то перед тем, как чистить опята, их можно замочить в емкости с теплой водой. Слишком долго (более часа) держать грибы в воде не стоит, они могут сильно напитаться влагой и потерять вкус.

После замачивания можно любым удобным способом (например, с помощью щетки) удалить имеющееся загрязнение. В таком случае чистить опята будет гораздо проще, чем при сухом способе.

Самое дорогое, что нам дается в жизни, это здоровье. Поэтому за ним следует следить регулярно. Особое внимание следует уделять воде, на которой мы ежедневно готовим пищу. Химический анализ воды очень важен. Подробности на сайте.

Лесные опята хороши в жареном и маринованном виде. С ними получается очень вкусный суп, особенно, если грибы сушеные. Как нужно правильно чистить опята, чтобы дальше их начинать готовить — об этом и пойдет речь в статье.

Общие правила чистки опят

  • Грибы переберите и удалите поломанные и червивые.
  • Обрежьте острым ножом самые нижние части ножек, где могут быть остатки земли и песка.
  • Опята, в отличите от некоторых других грибов, не имеют на шляпке слизистой пленки. Так что снимать ее не нужно, что очень упрощает дело.

Если грибов лесу очень много, то можете брать только их шляпки, чтобы в дальнейшем не чистить ножки.

Как чистить опята для дальнейшего консервирования

У некоторых видов опят на ножке есть так называемая юбочка — в рассоле она размокает и выглядит не очень эстетично. Так как маринованные грибы подаются в виде закуски, а она должна быть красивой, то юбочку эту лучше удалить с помощью тонкого ножа. И конечно, перед маринованием грибы хорошо вымойте в проточной воде.


Как чистить опята для дальнейшей жарки

Для жарки опята обработайте как указано в пункте 1 этой статьи. Юбочку можете не удалять, ведь при жарке она усохнет и ее не будет видно.


Как чистить опята для дальнейшей варки в супе

Чистка опят для супа зависит от того, какое блюдо будет готовить хозяйка. Для супа-пюре удалять юбочку не стоит, ведь грибы перебьются блендером и превратятся в однородную массу. Для прозрачного супа, чтобы он был красивым, юбочку можно и удалить.


Как чистить опята для дальнейшей сушки

Сушеные опята обладают насыщенным вкусом и ароматом и хороши в любых блюдах. Грибы перед сушкой обрабатывайте так:

  • Переберите от мусора.
  • Срежьте нижние части ножек.
  • Удалите юбочки.
  • Мягкой щеточкой удалите пыль и песок со шляпок.
  • Чистые сухие опята наденьте на нитки (используйте длинную иглу) и повесьте их в теплое проветриваемое место для сушки.
  • Перед готовкой сухие опята вымочите в холодной воде — с них уйдет оставшийся песок.


Чтобы почистить опята, их перед этим нужно собрать в лесу. Где они растут и как выглядят, смотрите в видео-ролике.

Небольшие грибочки с круглыми шляпками появляются дружными группками на зеленых лугах или пнях. Ароматные, щедрые на урожай опята обладают нежным вкусом и пригодны для разнообразных грибных блюд. Их успешно солят, маринуют, варят и готовят жаркое. Немного маленьких душистых грибов сдобрят картофельный суп или макароны, сделав самое простое блюдо оригинальным, сытным и полезным.

Виды опят

Различают несколько видов, которые отличаются временем и местом произрастания, а также вкусовыми свойствами и внешним видом.

Осенние опята (настоящие) (Armillaria mellea)

Группы осенних или настоящих опят можно повстречать в конце лета и начале осени на пнях и живых деревьях, чаще всего на березе, реже на осинах, кленах и других лиственных породах.

Этот, самый вкусный и ароматный вид является довольно крупным и характерен округлой шляпкой диаметром 5–12 см, поначалу выпуклой, а затем широкой, которая с возрастом становится гладкой, распростертой, бурого цвета. Молодая кожица светло-коричневая и словно присыпанная темной чешуйчатой крошкой.

Ножка стройная, высотой до 10 см, с типичным кольцом белого цвета, вверху расцветка светло-кремовая, у основания более темная. Пластинки белые, мякоть приятного кисловатого, чуть терпкого вкуса.

Ранние небольшие грибочки с оранжево-бурой шляпкой и приметным водянистым участком в центре появляются на деревьях, начиная с конца мая вплоть до поздней осени. Шляпка диаметром до 5 см со временем раскрывается и сбрасывает нижнее покрывало. Ножка тонкая, полая, высотой до 6 см с темным кольцом.

Грибы срастаются в колонии, плотно сидят на поврежденной древесине лиственных пород деревьев. Пластинки кремово-коричневые, мякоть буровато-рыжая, хрупкая, с тонким запахом свежего дерева. Плодовое тело слегка горчит и может быть использовано только в отварном виде.

Стайки солнечных луговых опят появляются среди луговой травы, на опушках и вдоль лесных вырубок, начиная с мая, а уже к концу лета исчезают. Шляпка маленькая, диаметром около 3 см, с небольшим возвышением по центру, и кожицей бежево-оранжевого цвета. Ножка тонкая, высотой до 7 см. Пластинки кремовые, редкие, мякоть желтоватая, приятного сладковатого вкуса.

Часто формируют колонии в виде кругов, оставляя по центру пустую проплешину. В старину это явление называли ведьмиными кругами. На самом деле объяснение простое – созревшие споры выбрасывают во все стороны длинные тонкие паутинообразные нити, на окончаниях которых вдоль всей окружности поднимаются плодовые тела. По центру грибной полянки остается мало питательных веществ, поэтому трава там не растет, высыхает, образуя небольшие круглые пустоши.

Даже во время зимних оттепелей под снегом на старых тополях или ивах можно отыскать красивые ровные шляпки зимних опят. Они среднего размера, диаметром до 8 см, цвет кожицы охристо-бурый, в сырости она скользкая, гладкая, в сухую погоду глянцевая. Ножка полая, бархатистая, высотой около 6 см, заметно темнеет к основанию, меняя цвет от светло-коричневого в верхней части до темно-бурого или бордового внизу. Тонкая мякоть кремового цвета, нейтрального вкуса, с еле уловимым грибным ароматом, пластины кремовые, частые.

Зимние опята хороши отваренными, маринованными и в соленьях. Удивительно приятно в холодную пору из-под снега собирать эти дары природы. Вид культивируется в промышленных масштабах и известен под названиями «иноки» и «энокитаке».

Места распространения и время сбора

В середине мая стройный грибной хоровод начинают летние опята , их же иногда называют весенними. Вид встречается вплоть до начала сентября, довольно часто среди влажных лесов, появляясь большими колониями на древесине лиственных пород. Целесообразно собирать их, срезая одни шляпки, так как полая тонкая ножка жесткая, волокнистая, и не представляет пищевой ценности.

В конце мая одиночно, а то и группками появляются луговые опята , которые вспыхивают теплым желто-коричневым цветом среди травы на лесных полянках, пастбищах, вдоль тропинок и овражков. Урожаи удается собирать до начала осени.

Конец августа и время первых моросящих дождиков – пора сбора настоящих или осенних опят . Найти их проще на древесине берез и осин ‒ на пнях и старых деревьях. Эти задорные грибочки собирают до поздней осени. Уже иней может серебрить траву, а они все еще виднеются на пеньках.

В середине сентября встречаются первые зимние опята , показываясь сросшимися группками на поваленных деревьях и пнях тополей, ив и кленов. Их появление – признак ослабленного или старого дерева. Отыскать их можно в лесах, в парках, старых фруктовых садах, искусственных насаждениях. Собирают плодовые тела не только на протяжении всей осени до наступления зимы и сильных морозов, но и во время зимних оттепелей, вплоть до прихода настоящего майского тепла.

Ложные опята

Всем хороши опята – урожайные, вкусные, душистые грибочки, которые можно собирать целый год. Но есть один существенный недостаток – наличие похожих видов, которые в лучшем случае относят к условно-съедобным, а в худшем, к ядовитым. Опасность усугубляется тем, что некоторые двойники не только очень похожи, но и произрастают рядом со съедобными грибами, буквально на том же пне.

Самый опасный из двойников, очень ядовитый вид. Шляпка истонченная, диаметром до 6 см, горчично-желтого цвета, напоминающего цвет серы, с темнеющим центром – бурым или бордовым. У молодых грибов шляпка выпуклая, у старых – широко распростертая. Пластинки сросшиеся с ножкой, желто-коричневые, позднее бурые. Ножка полая, выгнутая, зеленоватая, снизу темного оттенка. Мякоть ядовито-горькая, с отвратительным запахом, желтоватого цвета. Именно этот горький полынный вкус и препятствует серьезным отравлениям.

Встретить группки этих грибов можно, начиная с конца июня и по сентябрь, в местах роста съедобных видов. Кроме ядовитой окраски, горечи и неприятного запаха, ложные грибы можно отличить по окраске спор: у ложноопенка серно-желтого споры зеленоватые, у летних опят – коричневые, а у осенних – белые. Однако двойники, выросшие на хвойной древесине, могут и вовсе не иметь спор.

Заметным отличием настоящих опят является наличие кольца или «юбочки» – остатков сброшенного покрывала, чего нет у ложных видов.

Появляется небольшими колониями на гниющей древесине в конце лета и начале осени. Шляпка с крупным бугорком по центру, светло-желтая или кремовая, диаметром до 6 см, по краю покрыта белесыми хлопьями.

Мякоть хрупкая, тонкая, беловато-желтая, сначала пластинки грязно-белые, сероватые, с возрастом становятся лиловыми. Ножки тонкие, ломкие, в верхней части желтые, внизу бурые, у основания срастаются. Вид относят к условно-съедобным.

Яркий гриб формирует крупные колонии, заметные издалека своими красными тонами. Шляпки блестящие, рыжевато-красного цвета, светлые края обсыпаны сероватыми хлопьями. Мякоть горчично-желтая, горькая. Появляется поздней осенью на пнях лиственных пород, чаще дуба и бука.

Плодовые тела пригодны для употребления в пищу, но из-за горького вкуса требует двукратного отваривания со сменой воды.

Другое название ‒ псатирелла водянистая, и по поводу ее употребления нет единого мнения – иногда гриб считается несъедобным, а в других случаях условно-съедобным. Шляпка диаметром 3–5 см, слегка выпуклая или распростертая, с потрескавшимися истонченными краями. Кожица глянцевая, коричневая, при старении светлеет от цента и становится кремовой, на краях хлопьевидные остатки покрывала. Споры буро-фиолетовые.

Мякоть бурого цвета и характерной водянистой консистенции, нейтрального вкуса, иногда с легкой горчинкой, без запаха. Ножка до 8 см высотой, полая, часто изогнутая, в верхней части покрыта слабым мучнистым налетом.

Появляется в осенние месяцы в сырых местах вблизи деревьев или на пнях, остатках древесины как лиственных, так и хвойных пород. Иногда развивается в виде больших колоний.

Этот гриб ‒ близкий сородич предыдущего вида и также известен под именем псатиреллы Кандолля. Шляпка слегка выпуклая, затем распростертая, до 8 см диаметром, с радиально идущими от центра к краям морщинками, высыхая, становится белой или кремовой. Кожица буроватого цвета, у молодых грибов покрыта чешуйками, которые с возрастом исчезают. Мякоть тонкая, ломкая, безвкусная с легким грибным ароматом. Споры – буровато-лиловые.

Растет псатирелла Кандолля, начиная с конца весны и до начала осени, группами на древесине лиственных деревьев и у пней. Использование в пищу спорное – гриб считается условно-съедобным или несъедобным. Ценители находят его довольно вкусным, вымачивая, отваривая, а затем используя для маринадов и жарки.

Все перечисленные условно-съедобные виды перед употреблением долго отваривают, несколько раз меняя воду, и лишь затем используют в пищу.

Полезные свойства

Опята признаются вкусными, ароматными грибами и, будучи урожайными и доступными, с охотой собираются грибниками. В состав плодовых тел входят легкопереваримые белки, в том числе ценные аминокислоты. При этом они обладают невысокой калорийностью – всего 18–20 ккал на 100 г готового продукта и могут успешно употребляться как источник ценных питательных веществ при похудении.

Опята богаты полезными для кроветворной системы микроэлементами – цинком и медью, всего 100 г этих грибочков удовлетворят суточную потребность в данных элементах. В них присутствуют витамины группы B, особенно много тиамина, и аскорбиновая кислота, позитивно воздействующие на иммунитет и нервную систему.

В составе зимних опят было обнаружено противораковое вещество фламмулин, которое оказывает угнетающее действие на развитие саркомы.

В тканях опенка лугового исследователями были найдены антибактериальные соединения, замедляющие развитие золотистого стафилококка и других вирулентных микроорганизмов.

Противопоказания к употреблению

Опята разных видов выращиваются в промышленных масштабах на древесных отходах или соломе, считаясь полезным пищевым продуктом, а в некоторых странах – деликатесом.

И все же употребление в пищу сопряжено с рисками для людей, страдающих воспалительными процессами желудка и поджелудочной железы.

Противопоказания к употреблению – болезни печени и желчного пузыря, в том числе, его резекция.

Неправильно приготовленные, недоваренные грибные блюда без достаточной термической обработки, могут вызвать расстройство пищеварения и аллергические реакции.

Грибные продукты не должны быть включены в питание детей младше трех лет, беременных и кормящих женщин.

Рецепты блюд и заготовок

Перед переработкой грибы тщательно моют и чистят. В большинстве случаев ножки не имеют питательной ценности (кроме осенних опят) и поэтому их удаляют. Чтобы удачно помыть хрупкие шляпки, их погружают в дуршлаг и многократно окунают в таз с чистой водой, которую меняют по мере загрязнения.

Соленье из осенних опят

На 1 кг осенних опят берут 50 г соли, 20 г укропа – зелени и семян, 20 г лука репчатого, по вкусу душистый перец и лавровый лист.

Грибы заливают кипящей подсоленной водой и отваривают в течение 20 минут, а после варки откидывают на дуршлаг. Предварительно в подготовленную тару насыпают тонкий слой смеси укропа с перцем и солью. После остывания заготовку укладывают в емкость рядами толщиной 5–6 см, посыпая каждый слой смесью соли и пряностей, а также нарезанным мелко луком.

Сверху соленье накрывают отрезом ткани, придавливают кружком и грузом, и выносят в прохладное место, следя, чтобы рассол их полностью покрыл, что должно произойти через несколько дней. Готово кушанье бывают через две недели, после чего его хранят в холодильнике.

Замороженные опята

Один из лучших способов сохранить питательную ценность грибов надолго – замораживание. Это простой и нетрудоемкий метод, позволяющий отложить процесс готовки на свободный от работ зимний период. Перед замораживанием грибы очищают, промывают и обсушивают. Затем заготовку укладывают в порционные полиэтиленовые пакеты или пластиковые контейнеры, и устанавливают в морозильную камеру.

Такой замороженный продукт может храниться при глубокой заморозке в ‒18°C до следующего урожая. Достав из морозильника порцию, тут же приступают к приготовлению, не дожидаясь полного размораживания.

Опята консервированные

Для консервации пригодны свежесобранные шляпки. Их моют и заливают холодной водой из расчета 200 г воды на 1 кг грибов. Затем варят на слабом огне до начала выделения сока, после чего продолжают варку еще полчаса, снимая пену и часто помешивая. Солят заготовку по вкусу, добавляют немного лимонной кислоты – 1 г на 1 кг грибов.

На дно банок кладут лавровый лист, перец черный и душистый. Кипящие шляпки раскладывают в банки, и заливают грибным отваром. Консервацию стерилизуют не менее 40 минут.

Видео об опятах

Разнообразные опята, компактно произрастающие у пней и среди сочной луговой травы, полезны, питательны и вкусны. Они пригодны для заготовок, первых и вторых блюд, содержат ценные антибактериальные вещества, витамины и минералы. Знающий грибник не обойдет стороной эти маленькие ароматные грибочки, и для них всегда найдется место в лукошке, возле благородных боровиков и ярких рыжиков.

Поход в лес за опятами в любом случае принесет вам приятные эмоции, так как эти грибы растут большими семьями и, найдя подходящее дерево, вы быстро сможете наполнить корзинку. Сбор проводят практически круглогодично, так как видов этих грибов существует много, и их можно собирать даже зимой. Но для этого нужно не только знать, как выглядят съедобные виды, но и по каким правилам проводят их сбор.

Особенности и способы сбора зимних, весенних и осенних опят с фото и видео вы найдете в этой статье. Она поможет опытным грибникам усовершенствовать свои знания, а новичкам — освоить необходимую технику.

С наступлением первого осеннего месяца приходит время сбора опят. В условиях повышенной влажности они растут очень быстро. Встретить их можно как в лиственных, так и в смешанных лесах на пеньках и старых деревьях (рисунок 1). Хотя эти они небольшие, но собирать их — настоящее удовольствие, ведь растут они целыми семьями, и можно сразу набрать целую корзинку ароматных лесных даров.


Рисунок 1. Места и правила сбора опят

Иногда они скрываются под слоем опавшей листвы, и тогда найти их становится труднее, но как велика радость грибника, обнаружившего семейство, произрастающее на пне. Любители тихой охоты хорошо знают особенности, условия и правила сбора, а новичкам будет полезно ознакомиться с материалами данной статьи.

Особенности

Следует знать, что различные виды можно собирать практически круглый год, кроме периода сильных заморозков. Так, осенние собирают с августа по ноябрь, луговые — с мая по июнь и с сентября по октябрь, летние плодоносят с августа по октябрь, а зимние — на протяжении всей осени до морозов.

Примечание: Искать их нужно в достаточно взрослых лиственных лесах, на пнях и стволах поваленных деревьев, а иногда и на живой древесине. Исключение составляют луговые, которые растут исключительно на открытой местности среди травы. Ищите их на лесных опушках, пастбищах, полях, лугах.

Во время сбора будьте внимательны и помните, что наряду со съедобными вы можете встретить и ложные, среди которых есть и ядовитые. Чтобы такой экземпляр случайно не оказался в вашей корзине, научитесь различать настоящие и ложные экземпляры (рисунок 2).

Вот на что следует обратить внимание

  1. Настоящие опята растут только на древесине, в то время как ложные могут расти и на земле.
  2. Шляпки ложных видов окрашены в яркие тона — ярко-красные, зеленовато-серые, а пластинки на их обратной стороне имеют темный окрас.
  3. Главным признаком съедобности является кожистое кольцо на ножке под шляпкой. Ложные имеют обрывки такого кольца, при этом они плохо заметны. Кроме того шляпка и ножка настоящего гриба покрыты чешуйками, которые полностью отсутствуют у ложных.

Рисунок 2. Основные отличия настоящих и ложных видов

Кроме того, настоящие сорта имеют приятный грибной аромат, в то время как от ложных исходит неприятный землистый запах.

Условия

Хотите собрать урожай — отправляйтесь в лес, возраст которого превышает 30 лет. В таком лесном массиве можно найти достаточно мест, в которых любят произрастать опята — трухлявых пней, погибших стволов, валежника, выступающих корней деревьев.

Когда собирать зимние и другие вида? Лучшим временем для этого называют раннее утро, поскольку именно тогда они еще свежие и плотные после ночной прохлады, а значит, более устойчивы к транспортировке и хранению.

Способы

Выбирая способ сбора, следует отдать предпочтение таким, которые предохраняют грибницу от механических повреждений. Поэтому недопустимо выдергивать грибы, ведь такие действия приводят не только к повреждению грибницы, но и к ее гибели, в результате чего рост на данном участке прекращается.

Рекомендуется аккуратно срезать ножом ножку или выкручивать гриб из грибницы. Однако при первом способе существует риск проникновения инфекции в грибницу через резаную рану на ножке, поэтому лучше воспользоваться вторым способом. Выкручивая гриб, его необходимо поворачивать вокруг своей оси до тех пор, пока он легко не отделится. Оставшуюся после таких действий ямку нужно притоптать или слегка прикопать.

Правила

Всем любителям «тихой охоты», будь то опытный грибник, или начинающий, необходимо соблюдать следующие правила (рисунок 3):

  1. Можно собирать только хорошо знакомые виды. При малейшем сомнении по поводу съедобности следует отказаться от него.
  2. Рекомендуется подбирать молодые здоровые грибы, ведь они обладает способностью аккумулировать в себе опасные токсические вещества, а потому переросшие, червивые, трухлявые экземпляры вам ни к чему. Лучше подвесить его на ветку шляпкой вниз, чтобы ветер смог разнести и рассеять его споры для будущего урожая. Вместе с тем не следует собирать слишком молодые, еще не созревшие грибы. Оставьте их другим грибникам.
  3. Стараться не повредить грибницу. Поэтому трубчатые виды лучше выкручивать, а пластинчатые и сумчатые — ломать или срезать.
  4. Обнаружив съедобный гриб, не спешите покидать это место. Большинство видов растет целыми семьями, поэтому на одном месте при внимательном поиске можно обнаружить много грибочков.
  5. Помните, что грибы не растут в высокой траве и буреломе.
  6. Отправляясь в лес, прихватите с собой корзинку, а не ведро, поскольку в замкнутом пространстве без проветривания грибы быстро задыхаются.
  7. Перед тем, как отправить свою находку в корзину, очистите ее от земли и мусора. Укладывайте их шляпками вниз или боком.
  8. Не пытайтесь унести из лесу все грибы. Это невозможно. Сырые грибы быстро портятся, поэтому их необходимо быстро обработать.

Рисунок 3. Способы и правила сбора

Не сбивайте незнакомые грибы. Ведь может найтись грибник, который не только опознает этот гриб, но и подберет его.

Сбор опят: видео

Чтобы лучше узнать о процессе сбора, рекомендуем ознакомиться с видео, в котором показано, где искать грибы, как их различать и правильно собирать.

Когда собирать зимние опята

Большинство грибов собирают в летне-осенние месяцы. Исключение составляют зимние сорта, урожай которых можно собирать даже с наступлением небольших холодов в декабре месяце, а в условиях ранней и теплой весны — в январе и марте. Они появляются в лесу в октябре и могут продолжать плодоносить до марта (рисунок 4). Все зависит от климатических и погодных условий, поскольку при температуре ниже ноля рост прекращается.


Рисунок 4. Сбор зимних видов

Перепутать зимний сорт с любым другим видом очень сложно, поскольку большинство грибов не переносят холодов, и с их наступлением отмирают в своей надземной части, а значит, попросту отсутствуют.

Когда собирать весенние опята

Весенние опята относятся к ранним видам. Их можно встретить как в смешанных, так и в хвойных лесах на старых пнях и выступающих корнях деревьев, а также на влажной мшистой подстилке в период с середины мая и до конца октября (рисунок 5).


Рисунок 5. Особенности сбора весенних видов

Наибольший урожай можно собрать в июне-июле, когда эти грибы особенно плодовиты, а поскольку растут в малогрибной сезон, то вызывают повышенный интерес грибников.

Сбор осенних опят: видео

Самыми популярными считаются осенние сорта. Из приведенного ниже видео вы узнаете, как их правильно собирать и какие места в лесу следует осмотреть, чтобы найти богатый урожай грибов.

Читайте также…

【решено】 Как сохранить грибы в меду

Как сделать опята?

Добавьте грибов , посолите и поперчите. Обжаривайте 1-2 минуты, пока они не станут нежными. В небольшой миске взбейте бальзамический уксус, меда и измельченный чеснок. Добавьте соус к грибам и продолжайте тушить в течение 3-5 минут, пока соус не станет мягким и грибов не станут мягкими и покрыты соусом.

Как долго сушеные грибы остаются хорошими?

Сушеные грибы хранятся бессрочно при хранении в герметичном контейнере в прохладном темном месте.

Как сушить грибы естественным путем?

Секрет сушки грибов без дегидратора — не такой уж большой секрет. Вы просто проветриваете , сушите их. Правильно — просто поместите их в открытый контейнер с хорошей циркуляцией воздуха под ними (сетчатый дуршлаг отлично подходит для этой цели) и оставьте их сушиться примерно на неделю.

Как хранить сушеные грибы шиитаке?

Сушеные грибы шиитаке должны быть запечатаны в пластик, а хранить в прохладном, сухом месте.Они будут хранить как минимум девять месяцев.

Как долго консервировать грибы?

Хранение:

  1. Храните грибы в оригинальной упаковке или в пористом бумажном пакете в течение продленного срока хранения .
  2. Некоторые грибов можно хранить в холодильнике до одной недели.
  3. Свежие грибов никогда не следует замораживать, но замороженные тушеные грибов сохранят до одного месяца.

Сушеные грибы шитаке портятся?

Барагани говорит, что сушеных грибов лучше всего хранятся в закрывающемся пластиковом пакете или, предпочтительно, в герметичном контейнере. «Пока сушеных грибов хранятся в , сушеных грибов могут храниться бесконечно», — говорит Барагани.

Можно ли отравиться вареными грибами?

Употребление продуктов, содержащих ядовитые токсины , может также вызвать пищевое отравление .Эти токсины могут естественным образом присутствовать в продуктах , таких как некоторые виды грибов , или продуцироваться бактериями в продуктах питания , которые испортились.

Как дезинфицировать грибы?

Следует ли мыть грибы?

«Все дикие грибы должны быть промыты , и очень важно их потом высушить», — говорит Джозеф Рицца, шеф-повар Prime & Provisions в Чикаго.«Выращенные грибов , такие как пуговицы и портобелло, можно очистить , используя сухую ткань или бумажное полотенце, чтобы стереть лишнюю« грязь », на которой они выросли.

Следует ли мыть грибы перед едой?

Стоит ли мыть грибы Собираетесь готовить? Если они целы, да. Открытая мякоть будет впитывать воду, как губка, поэтому ополосните грибы, прежде чем нарезать их ломтиками. И будьте осторожны, , а не , мыть грибы, пока вы не будете готовы их приготовить, иначе они станут слизистыми.

Что будет, если не мыть грибы?

Вот почему вы никогда не должны мыть грибы : После намокания грибов практически невозможно полностью высушить, что снижает вероятность , что они приобретут желанный золотистый цвет и хрустящие края , когда Вы их обжариваете. Чтобы получить самую хрустящую корочку, начните с совершенно сушеных грибов .

Можно ли есть сырые грибы?

В то время как грибов можно есть сырыми и они могут оказывать благотворное влияние на пищеварительную систему, некоторые методы приготовления, как было показано, увеличивают их питательную ценность, особенно если их приготовить на гриле или в микроволновой печи.

Можно ли заморозить грибы?

Вы можете хранить грибов в морозильной камере до 12 месяцев. Их можно добавлять в блюда, которые вы собираетесь тщательно готовить. Или дайте им оттаять в холодильнике, пока они не станут достаточно мягкими, чтобы их можно было использовать.

Стоит ли мыть нарезанные грибы из магазина?

В большинстве случаев, грибы до нарезанные в магазине говорят, что они уже были вымыты , но если вы, , видите немного грязи, вам, , возможно, захочется снова очистить .Для очистите нарезанные ломтиками грибы , встряхните их на дуршлаге, чтобы удалить грязь, затем быстро промойте непосредственно перед , когда вы готовы к приготовлению.

Грибы лучше покупать целые или нарезанные?

Если вы бакалея — делайте один или два раза в неделю, целых грибов стоят работы; они хранятся в холодильнике около семи дней. Но если вам не нужна эта долговечность, не стесняйтесь сэкономить время и возьмите нарезанных кусочков.

Можете ли вы заранее нарезать грибы?

Ничего страшного. Идите вперед и смойте их! Чистые, без крошки грибов — ваш выигрыш. Я делаю все раз . Они действительно поглощают крошечное количество воды, но ничего, что помешало бы вам хорошо поджарить эти грибов на сковороде.

Можно ли предварительно нарезать грибы?

Грибы нежные, а их высокое содержание влаги делает их очень скоропортящимися.«Я обычно не думаю, что до нарезанных грибов — это здорово — нарезание их заранее означает, что они высыхают и портятся быстрее», — объясняет Молли Баз, старший редактор отдела кулинарии Bon Appétit. «Они просто не остаются такими свежими».

Секрет хрустящих грибов? Не мойте их!

Грибы, особенно сковорода, полная обжаренных мясистых грибов, — одно из простых удовольствий в жизни. К сожалению, многие из нас портят свои грибы, кладя их под кран, как только мы приносим их домой из магазина.

Никогда не мыть грибы , так как мокрые грибы практически невозможно сушить. Это снижает вероятность того, что они приобретут красивый золотистый цвет и хрустящие края, когда вы их обжарите. Что еще хуже, если вы моете и храните свои грибы в герметичном контейнере или полиэтиленовом пакете, они очень быстро станут липкими и ужасными.

По-прежнему можно дать грибам хорошую « химчистку », как только вы принесете их домой, и хороший метод — это взять кисточку для сухого теста или мятое бумажное полотенце, чтобы аккуратно смахнуть с них любые кусочки грязи или мусора. им.

Культурные грибы, которые вы найдете в местном супермаркете или продуктовом магазине, были выращены в стерилизованном компосте, поэтому вероятно, что что-то, что цепляется за ваши грибы, не вызовет у вас болезни, а это самое главное.

Если вы добываете грибы, такие как лисички, сморчки и черные трубы, к ним часто прилипают сосновые иглы и другой мусор, что делает их очистку более необходимой. Метод « химчистки» отлично подойдет и для этих грибов.

Это может показаться неудобным, но если у вас есть выбор между чистыми и грязными грибами, берите каждый раз грязные, даже если это означает их чистку. Это гарантирует, что никто не мыл и не хранил грибы неправильно, и что они настолько свежие, насколько это возможно.

Интересные факты о грибах

• Грибы обладают собственной иммунной системой.

• Грибы более тесно связаны по ДНК с людьми, чем с растениями.

• Медовый гриб (Armillaria ostoyae) — самый крупный из известных организмов в мире.Он покрывает колоссальные 2384 акра (почти четыре квадратных мили!) Земли в Голубых горах Орегона. По оценкам, ему 2400 лет, но может быть и 8650 лет.

• В грибах больше аминокислот, чем в кукурузе, арахисе или сое.

• Грибы используют антибиотики, чтобы избавиться от других микроорганизмов, которые конкурируют с ними за пищу.

• Семейство грибов Mycena включает более 70 видов грибов, которые светятся в темноте. Грибы излучают свет благодаря процессу, называемому биолюминесценцией, и в прошлом люди якобы освещали свой путь через лес, используя светящиеся куски древесины, колонизированной грибами.

Приготовление пищи с лесными грибами — Грибная гора

Когда вы в лесу собираете пищу, вы на самом деле не просто ищете грибы, вы вдали от повседневной рутины, не думаете ни о чем другом, но наслаждаетесь природой и дикой природой. Это. Неудивительно, что японцы прописывают «лесные купания» как форму психиатрической помощи. Лес действует на вас психологически и физически. И нам всем нам нужно делать больше, поскольку психическое здоровье ухудшается во всем мире. Так что иди туда, полежи в лесу и собери несколько грибов.

Теперь у вас есть корзина, наполненная лесными дарами, всевозможными грибами: лисичками, сморчками, сочным бифштексным грибом или золотым молочком, а может быть, и белыми грибами. Даже мысль обо всех них вызывает у меня улыбку. Вы приносите их домой, чистите и готовы приготовить вкусную еду для себя, семьи и друзей.

Я включил сюда несколько простых рецептов, над которыми экспериментировал на протяжении многих лет. Надеюсь вам нравится!

  • Свежие белые подберезовики
  • Соль и перец
  • Оливковое масло

Метод:

Очистите нижнюю часть грибов от грязи ножом.Грибы нарезать тонкими ломтиками, шляпки и стебли (не отделять) и выложить на сервировочную тарелку. Сбрызнуть оливковым маслом, приправить солью и перцем. (Большинство грибов следует приготовить перед употреблением в пищу, но королевские болеты — это деликатес в сыром виде)


Настойка рейши и бузины

Состав:

  • Свежий или сушеный Рейши (нарезанный)
  • Свежая или сушеная бузина
  • Мед (местный, желательно органический)
  • Бренди
  • Банка для консервирования

Метод:

Поместите рейши и ягоды бузины в банку, наполнив ее на 1/3.Смазать медом. Залейте в бутылку бренди. Плотно закройте банку и хорошо встряхните. Встряхивайте банку каждый день в течение следующих 10 дней, а затем один раз в неделю в течение следующих 5 недель. Теперь ваша настойка готова к употреблению. Отлично подходит для предотвращения простуды и гриппа, отлично подходит для воспалений, таких как артрит, аллергия, сон и многое другое.

Морель тост

Состав:

  • Сморчки (свежие или сушеные)
  • Сливочное масло
  • Свежий чеснок
  • Соль и перец
  • Ломтики сыра (ваш любимый)
  • Свежий хлеб

Метод:

Если вы используете сушеные сморчки, сначала разведите их в теплой воде (экономьте жидкость).Обжарьте сморчки в масле с чесноком. Жидкость, которую вы использовали для регидратации сморчков, добавления ее в соте и выпаривания, в этой жидкости есть тонны аромата. Отложите в сторону. Намазать маслом кусок хлеба и выложить сначала сыр, а затем сморчки. Тост в тостере. Подавать немедленно. Наслаждаться!

Пицца с медом и грибами

Состав:

  • Тесто для пиццы
  • Соус для пиццы
  • Любимый сыр для пиццы
  • Свежие опята
  • Анчоусы (можно не указывать)
  • 1/2 банки любимого пива
  • Сливочное масло
  • Чеснок
  • 1/2 луковицы
  • Соль и перец

Метод:

Нарезать опята нарезанными и обжарить в масле с луком, а затем с чесноком.Как только грибы начнут карамелизироваться, медленно, постепенно добавляйте пиво и продолжайте его выпаривать. Приправить солью и перцем и отложить. Соберите пиццу, положив сначала небольшое количество сыра на тесто, чтобы соус для пиццы не впитался в тесто. Далее кладем соус для пиццы, а затем карамелизированные грибы и анчоусы. Выпекайте и наслаждайтесь!

Киноварь поверх стейка

Киноварные лисички обычно крошечные, и для еды их нужно много.Но почему они мне очень нравятся, так это потому, что, когда вы их готовите, они сохраняют оранжевый цвет, поэтому мне нравится использовать их в качестве гарнира к блюдам.

Состав:

  • Киноварь свежая
  • Чеснок
  • Соль и перец
  • Сливочное или оливковое масло

Метод:

Очистите свои грибы. Возможно, вам придется делать это в воде (я обычно не рекомендую этого с другими грибами), потому что они обычно очень песчаные. Обжарить их целиком с чесноком на оливковом или сливочном масле, приправить солью и перцем.Подавать со стейком и подливой с картофельным пюре. Вкусные.

Куриный суп с хвостом индейки

Хвосты индейки древесные и на вкус как картон, но они обладают большим ароматом и лечебными свойствами.

Состав:

  • Хвосты индейки
  • Ингредиенты для любимого рецепта куриного супа

Метод:

Следуйте инструкциям по приготовлению тушеной курицы, и когда все будет готово к кипячению, добавьте в смесь горсть целых хвостов индейки.Когда вы закончите закипать и будете готовы к подаче, выньте хвосты индейки, потому что они все равно будут похожи на картон. Жара помогла им выпустить в рагу все лечебные вкусности. Наслаждайтесь лечебным куриным супом.

Фри с вешенками

Это всегда хит на всех наших мастерских, я никогда не смогу заработать достаточно.

Состав:

  • Вешенки свежие
  • Мука
  • Яйца
  • Молоко
  • Любимые специи — люблю соль, перец, измельченный розмарин
  • Масло для жарки
  • Майонез (предпочитаю Dukes)
  • Соус Шрирача

Метод:

Нарежьте вешенки на жабры, придав им форму картошки фри.Отложите в сторону. В глубокой посуде смешайте несколько яиц, молоко, соль и перец. Обмакните в смесь грибы и оставьте на 10 минут. Присыпать мукой, снова обмакнуть в молочно-яичную смесь и снова посыпать мукой. Потом жарим. снова приправить солью, перцем и измельченным розмарином. Кроме того, смешайте майонез и шрирачу, чтобы вы могли макать кусочки, прежде чем они попадут в рот и станут красивыми и хрустящими. Наслаждаться!

Бифштекс Сашими

Состав:

  • Свежие грибы бифштекс
  • Оливковое масло
  • Лимонно-перец приправы
  • Соль

Метод:

Нарезать бифштекс тонкими ломтиками и разложить на тарелке.Сбрызнуть оливковым маслом и специями. Наслаждаться! (Я не рекомендую есть большинство грибов в сыром виде, но с этим все в порядке)

Порежьте львиную гриву на квадраты размером с укус. Оставьте на 20 минут в смеси молока, яиц, соли и перца. Львиногрив впитает всю эту смесь. Обвалять в хлопьях панко или в муке и обжаривать во фритюре. Для соуса: кетчуп, горчица (я использовала серый пупон), сыр пармезан и тадаааааа, отличная закуска. Это происходит быстро. Я даже тестировал его на своих кошках, и они его съели, LOL.Теперь вы можете кормить грибами и своих питомцев, хе-хе-хе-хе!

Можно ли есть грибы во время беременности? Полное руководство

Последнее обновление 28 сентября 2021 г.

Многие беременные женщины знают, что во время беременности им необходимо увеличить потребление продуктов, богатых питательными веществами, а фрукты и овощи возглавляют этот список. Поскольку грибы питательны и универсальны, кажется, их есть отличная идея, не так ли? Ответ не так однозначен.

Можно ли есть грибы во время беременности? Беременным женщинам можно есть большинство видов съедобных грибов, если их предварительно очистить и тщательно приготовить.Это связано с тем, что почва на немытых грибах может содержать toxoplasma gondii, а сырые грибы также могут вызывать дискомфорт в желудке.

Существует так много разных видов грибов (и способов их подачи), что я решила написать это полное руководство по грибам во время беременности. Надеюсь, после прочтения, независимо от того, как вы едите или заказываете грибы, вы сможете безопасно наслаждаться ими. В конце концов, они вам подходят! (подробнее об этом позже)

Примечание. На этой странице описаны только кулинарные, съедобные грибы. «Волшебные грибы» или «грибы» типа псилоцибина, употребляемые в качестве развлекательного (и часто незаконного) наркотика, никогда не следует принимать во время беременности (источник: TRV).

Безопасное употребление грибов во время беременности

Если вы хотите безопасно есть грибы, помните следующее:

  • Беременным женщинам не следует есть сырые грибы. Это в основном связано с тем, что они выращиваются в почве, которая может быть источником Toxoplasma gondii, патогена, вызывающего токсоплазмоз.Токсоплазмоз — это редкое, но серьезное заболевание пищевого происхождения, которое может вызвать осложнения во время беременности, включая выкидыш (источник: CDC).
  • Сырые грибы, в зависимости от типа, также могут содержать различные количества агаритина , который предположительно является канцерогеном (источник: PubMed). Однако исследования по этому поводу ограничены, и нет достаточно достоверной информации, чтобы сделать вывод.

    Маловероятно, что вы съедите столько грибов, чтобы достичь токсичного уровня агаритина, и нет исследований, показывающих его влияние на беременность.Однако по этой причине вы также можете избегать сырых, сырых грибов. Считается, что агаритин уменьшается при приготовлении пищи.

  • Грибы содержат хитин , который придает им мясную текстуру и высокое содержание клетчатки. Хитин плохо усваивается (источник: Mushroom Appreciation). Приготовленные грибы, в которых хитин больше расщеплен, с меньшей вероятностью вызовут расстройство желудка или дискомфорт, к которым вы можете быть более склонны во время беременности.
  • Грибы всегда следует тщательно мыть (не замачивать) , чтобы удалить следы грязи и мусора.Замачивание грибов приводит к их поливу, поэтому многие повара и повара предпочитают «чистить» грибы, пока они не станут чистыми.

    Однако из-за их физической формы следы почвы могут оставаться в щелях, например, между жабрами, поэтому лучше промыть грибы чистой проточной водой перед их приготовлением.

  • Приготовление грибов убивает поверхностные бактерии, а также убивает toxoplasma gondii, если она присутствует (источник: CDC). Поэтому чистка, а затем приготовление грибов — самый безопасный способ их есть во время беременности.
  • Не ешьте грибы, которые вы не идентифицировали , особенно те, которые собирают в дикой природе. Многие токсичные грибы выглядят идентично съедобным, поэтому на протяжении всей беременности лучше придерживаться известных кулинарных грибов, произведенных в промышленных масштабах. Это касается всех, а не только беременных! Список съедобных грибов, которые обычно можно найти в магазинах и супермаркетах, приведен ниже.

Способы приготовления грибов и безопасность при беременности

Если грибы чистить и готовить, их можно есть во время беременности.Во избежание сомнений, я перечисляю здесь различные способы приготовления грибов, о которых часто спрашивают:

  • Свежие грибы должны быть именно такими — как можно более свежими. Старые грибы, как правило, становятся слизистыми, а не плесневеющими, поэтому срежьте все мягкие слизистые пятна и проверьте, нет ли плесени или гниения на стебле (обычно это первое место, где гриб начинает портиться). Очистите их и приготовьте, и их будет безопасно есть.
  • Сушеные грибы следует замочить в горячей воде на 20-30 минут или следовать рекомендованным инструкциям на упаковке.Проверьте и удалите песок или песок. Не ешьте сушеные грибы в сыром виде и не используйте их в сыром виде. Всегда готовьте их в первую очередь. Жидкость для замачивания также отлично подходит для супов, рагу и ризотто.
  • Приготовленные холодные грибы можно есть, если вы беременны, например, в салате. Они могут заменить свежие сырые грибы.
  • Консервированные, маринованные или консервированные грибы можно безопасно есть во время беременности. Как и вареные холодные грибы (а по сути они и есть), они являются хорошей заменой сырым грибам, поскольку они уже приготовлены в процессе консервирования.Если это маринованные грибы, убедитесь, что они приготовлены.
  • Жареные во фритюре грибы или грибы в панировке безопасны, если вы беременны, при условии, что грибы тщательно прожарились внутри теста или в панировке. Разрежьте самый большой пополам и проверьте, готово ли оно до горячего пара, прежде чем класть в остальные. Это один из самых калорийных и жирных способов употребления грибов, поэтому во время беременности лучше всего его употреблять в умеренных количествах.

Грибные блюда и безопасность при беременности

Конечно, грибы не появляются сами по себе.Существует множество блюд, содержащих грибы, о которых вы, возможно, задумывались с точки зрения безопасности беременности. Вот некоторые из самых популярных:

  • Паштет из грибов небезопасен для употребления во время беременности , так как он может содержать листерию или сырое яйцо. Даже веганский грибной паштет не подходит для беременных, потому что высокое содержание воды делает его более восприимчивым к листериям (источник: NHS).
  • Грибной суп безопасен для беременных, в зависимости от других ингредиентов.Он часто выглядит как «грибной крем», который также безопасен для беременных, если пастеризованы другие ингредиенты, такие как сливки или молоко.
  • Фаршированные грибы обычно безопасны для беременных, поскольку они полностью приготовлены. Если у них холодная начинка, похожая на салат, проверьте, подходят ли вам ингредиенты, если вы беременны. Например, вы можете проверить этот список всех сыров, которые безопасны (и небезопасны) во время беременности.
  • Курица и грибы Пироги, макаронные изделия и т. Д. Подходят для беременных, если курица полностью приготовлена ​​до горячего пара, а также грибы.Никогда не ешьте недоваренное мясо во время беременности из-за риска заражения листерией или токсоплазмозом.
  • Грибы на пицце безопасны для беременных женщин, если они приготовлены как часть начинки (как правило, так и есть). Я написала полное руководство по начинкам для пиццы во время беременности, которое вы, возможно, тоже захотите прочитать.
  • Кофе с грибами — Кофе с грибами — это обычный кофе, смешанный с сушеными травяными грибами, такими как кордицепс, чага и львиная грива. Беременные женщины могут пить кофе, если они следят за потреблением кофеина и потребляют менее 200 мг кофеина.

    Однако смеси сушеных грибов, часто используемые в грибном кофе, еще не изучены в отношении их воздействия на нерожденных детей. Впоследствии лучше избегать употребления грибного кофе во время беременности, пока не станет известна дополнительная информация.

Список безопасных (и небезопасных) грибов во время беременности

Если вы дошли до этого руководства, то знаете, что большинство съедобных грибов можно есть, если их очистить и приготовить. Однако я знаю, что, когда вы беременны, вы хотите быть абсолютно уверены в том, что съедаемые вами виды грибов безопасны, и что вам нужна конкретная информация.

Ниже приводится список наиболее распространенных видов грибов, о которых вы, возможно, задумывались. Некоторые из них небезопасны во время беременности, потому, что их едят не в виде готового блюда, а в виде порошка или добавки в гораздо более высоких дозах.

  • Черный гриб можно безопасно есть во время беременности, если они тщательно приготовлены. Они часто бывают сушеными, или вы найдете их во многих азиатских и китайских блюдах. Покупайте их у надежного коммерческого поставщика, а не ищите для них пищу.Всегда замачивайте и тщательно готовьте черные грибы, и они должны быть хорошими для еды.
  • Пуговичные грибы , вероятно, являются одним из самых распространенных кулинарных видов. Шампиньоны безопасны для беременных, если их предварительно очистить и приготовить.
  • Грибы лисички безопасны для беременных, если их тщательно приготовить и сначала тщательно очистить. Это мои любимые грибы, но я часто обнаруживаю, что у них ОЧЕНЬ много грязи внутри и вокруг их жабр и стебля, когда они собираются в лесу, так что будьте осторожны при их чистке.Покупайте только в надежных источниках, так как некоторые несъедобные продукты выглядят точно так же.
  • Каштановые грибы можно есть беременным женщинам, если их очистить перед приготовлением. У них сильный вкус, поэтому их можно добавлять в различные блюда.
  • Грибы кримини также известны как «обычные грибы», так как они очень популярны и доступны во многих местах. Если в ресторане или магазине просто используется слово «гриб» в качестве ингредиента, скорее всего, это кримини.Беременным женщинам можно безопасно есть приготовленные очищенные грибы кримини.
  • Грибы эноки безопасны для беременных, если их готовят после очистки. Поскольку они популярны в салатах, грибы эноки — один из тех видов, которые вам, возможно, придется перепроверить, если вы не готовите эноки самостоятельно.
  • Грибы сморчка (или просто сморчки) безопасны для беременных женщин, если они были правильно очищены и приготовлены. Очистка сморчков сложнее из-за их губчатой ​​текстуры, и в их щелях может оставаться грязь, так что на это следует обратить внимание.
  • Вешенки безопасны для употребления, если они свежие (часто продаются в специализированных супермаркетах или продуктовых магазинах), а также были правильно приготовлены и очищены. В больших количествах они могут вызвать дискомфорт в желудке. Вешенки в качестве добавки не тестировались на безопасность при беременности, поэтому придерживайтесь только свежих, приготовленных продуктов (источник: VeryWellFit).
  • Белые грибы чаще встречаются сушеными, чем свежими, так как это усиливает их сильный вкус.Белые грибы, если их приготовить, безопасны для беременных женщин. Если вы используете их в сушеном виде, убедитесь, что они пропитаны должным образом, удалили или ополоснули всю грязь и песок, а затем тщательно приготовьте. Если они свежие, очистите их и готовьте полностью.
  • Грибы Portabella и Portobello безопасны во время беременности, потому что это просто альтернативные названия гриба кримини (описанного выше). Имена обычно относятся только к размеру. Если вы используете грибы большого размера (часто называемые портобелло), будьте особенно осторожны, чтобы приготовить их, так как они довольно толстые и мясистые.
  • Грибы рейши используются в восточной и китайской медицине. Они часто бывают в виде порошка или в виде добавок. Беременным женщинам следует избегать грибов рейши , потому что в небольшом количестве случаев они были связаны с повреждением печени. Недостаточно надежной информации о его воздействии, поэтому его лучше избегать (источник: Medline)
  • Грибы шитаке могут быть сухими или свежими, и оба вида грибов шитаке безопасны во время беременности.Обычно едят только шляпку, так как стебель очень волокнистый и жесткий. Если оно высохло, замочите, очистите и тщательно приготовьте, а если оно свежее, выбросьте стебель шитаке (или используйте его в бульоне), очистите и приготовьте крышки.
  • Дикие грибы может означать много разных видов, включая некоторые из этого списка. Коммерчески производимые сушеные грибы или свежие дикорастущие грибы, как правило, безопасны для употребления во время беременности, если их чистить и готовить, как и любые другие.

    Всегда удостоверяйтесь, что лесные грибы поступают из надежного источника , и во время беременности (или в противном случае) никогда не собирайте и не ешьте гриб в дикой природе, если вы не уверены, что это такое.Имейте в виду, что многие ядовитые грибы похожи на съедобные, поэтому, если вы не эксперт, держитесь подальше от грибов, которые можно найти в дикой природе.

Грибы — хороший и здоровый выбор для беременных?

Грибы, если их тщательно очистить и приготовить, станут хорошим выбором для беременных. В них нет холестерина и очень мало жиров и калорий, что делает их здоровым выбором из овощей (источник: NYT).

Грибы можно безопасно есть на ранних сроках беременности, а также во всех других триместрах.

Конечно, способ их приготовления может повлиять на то, насколько полезны грибы во время беременности. Жареные во фритюре, в панировке или фаршированные грибы добавят калорий и жира, тогда как обжаренные в чесноке грибы на цельнозерновых тостах по-прежнему являются вкусным, но гораздо более полезным вариантом.

Различные способы приготовления грибов и их безопасность во время беременности описаны выше.

Каковы преимущества употребления грибов во время беременности?

Помимо низкого содержания калорий и жиров, грибы являются отличным источником ряда важных витаминов, минералов и питательных веществ, которые вам понадобятся во время беременности.

Хотя это количество зависит от типа грибов, которые вы едите, в целом грибы являются хорошим источником антиоксидантов, таких как витамин С, селен и холин. Они также содержат различные витамины группы B, с высоким содержанием клетчатки, а также являются источником фолиевой кислоты, которая необходима при беременности (источник: Medical News Today).

В целом, грибы — отличный выбор для беременных, если их правильно чистить и готовить, чтобы они были безопасными.

Есть более здоровые способы подать их, чем другие, но относитесь к ним так же, как к любым другим здоровым овощам — ешьте их в более здоровых блюдах, таких как обжаренные, жареные или жареные грибы, а не жареные, фаршированные или в сливочных соусах.

Эта статья была рассмотрена и одобрена для публикации в соответствии с нашей редакционной политикой.

О коралловых грибах (и несколько рецептов с коралловыми грибами)

Коралловые грибы — лесной деликатес. Приходите в наше приключение с грибами, где я впервые собираю их, и ознакомьтесь с некоторыми из этих восхитительных рецептов коралловых грибов: азиатский суп из коралловых грибов и яичных кубиков, консервированные коралловые грибы и жареные коралловые грибы. (Перейти к рецептам.)

Мне снова позвонили. Это был Алекс, мой друг-сборщик грибов. Хочешь пойти и собрать со мной коралловые грибы?

Что это, черт возьми?

Я никогда о них не слышал — а вы?

Мое любопытство было возбуждено. Я должен был увидеть, что означают эти новые (для меня) грибы. Я представил себе большие, похожие на морщинки мозги куски коралла. Я надел свою потрепанную старую лесную одежду, и мы двинулись в путь.

Коралловые грибы растут на мертвых бревнах лиственных деревьев (в наших краях — тополи).Они появляются весной и в начале лета на бревнах, прячась в тени; обычно далеко в заросшие участки, требуя много нырять, карабкаться и цепляться за волосы, чтобы добраться до них. Это приключение.

Я люблю такие приключения.

Алекс, прикидывая возможное место

хммм, может здесь есть какие

да, я вижу мертвое бревно, на котором может быть что-то — следуйте за мной

Эти забавные маленькие коралловые грибочки совсем не похожи на мозг, который я себе представляла; вместо этого они подобны изящно разветвленным группам крошечных коралловых веточек, собранных вместе, как морские губки.Я бы прошел мимо них миллион раз и никогда не подумал бы, что они могут быть съедобными.

нашел!

Обнаруженный нами сорт называется коралловыми грибами с корончатым наконечником, потому что на концах каждой веточки есть крошечные зубцы, похожие на крошечные коронки.

И мы даже нашли два гриба особой разновидности коралловых грибов — hericium — известных как настоящий деликатес. Конечно, мы были так взволнованы, что налетели на них и забыли сфотографировать, пока они не оказались в ведре.

наш улов — пучок корончатых коралловых грибов и два больших белых герициума — они действительно выглядят как кусочки коралла

Я не очень разбираюсь в грибах и всегда доверяю знаниям моего друга-грибника. Она знала об этих грибах и собирала их раньше. Изучив их в ее большой книге о грибах, мы прочитали, что у коралловых грибов нет никаких ядовитых аналогов, поэтому я чувствовал себя довольно уверенно, узнавая их, и с нетерпением жду возможности проверить их в лесу вокруг нашего дома.

Hericium — это большой белый гриб забавного вида, который действительно напоминает кораллы, и считается восхитительным деликатесом, в котором есть легкий привкус морепродуктов. Это было действительно потрясающе. Я обжарил его в масле с луком-шалотом и свежим тимьяном, и мы разложили его, как драгоценности, на тарелку крем-супа. Думаю, это было бы прекрасно на омлете, в качестве гарнира к пасте или даже просто на тосте.

Чтобы собрать коралловые грибы, мы срезали их ножницами, оставив основание прикрепленным к бревнам, где мы могли.

Чистка коралловых грибов — дело непростое — убирайте остатки лесного мусора и обрезайте твердые основания, на которых могут остаться кусочки мха или бревна.

Промойте их несколько раз чистой водой, чтобы смыть песчинки, затем положите их на полотенце, чтобы они высохли, аккуратно промокнув сверху, чтобы смыть лишнюю влагу. Герициумам необходимо особое внимание, чтобы удалить песчаные кусочки, которые могут застрять в их мохнатых ветвях. Полезны грибная щетка или мягкая зубная щетка.

Hericium действительно выглядит как кусок нежного коралла, и на вкус он сладкий и восхитительный, с легким крабовым оттенком

После того, как они были очищены, я был рад попробовать придумать несколько рецептов коралловых грибов. Это был забавный и восхитительный эксперимент.

Несколько вкусных рецептов с коралловыми грибами

Суп в азиатском стиле стал абсолютным победителем в нашем доме. Я хотел продемонстрировать классные формы грибов, поэтому оставил их целыми и просто добавил в последнюю минуту — они действительно не требуют времени на приготовление.Этот фантастический суп можно приготовить из любых других грибов, которые у вас есть (я понимаю, что коралловые грибы — редкость). Можно даже очень тонко нарезать старые шампиньоны и положить их в суп. Это пикантный прозрачный бульон, усыпанный блестящими бусами черного риса (вы можете легко заменить коричневый рис), кубиками нежного яйца и кусочками ярко-зеленого лука. Фантастически нежный и ароматный.

Мне не удалось израсходовать все кораллы, которые мы собрали, поэтому я хотел сохранить некоторые из этих уникальных грибов для будущего использования.Я консервировал их в мягком рассоле для маринования — достаточно сильном, чтобы поднять pH до безопасного уровня для консервирования, но не настолько кислым, чтобы грибы превратились в соленья. Я хотел, чтобы они были достаточно мягкими, чтобы я мог использовать грибы позже в рецептах (например, снова приготовить вкусный суп) и поэкспериментировать с некоторыми новыми идеями. Они также станут отличным гарниром к любым блюдам.

Затем с этими двумя прекрасными гербицидами я просто очистил их, нарезал и быстро обжарил на масле с луком-шалотом и свежим тимьяном.

Их вкус нежный, на полпути между свежими грибами и сладким крабовым мясом — чудесный небольшой гарнир поверх легкого крем-супа, пасты, тоста или омлета. Если бы у вас было побольше, они бы сами приготовили красивое грибное блюдо, но поскольку у нас были только эти два герициума, я приготовил их осторожно, и мы смаковали их как гарнир.

обжаренные коралловые грибы Hericium в виде восхитительного гарнира поверх нежного крем-супа из гороха и салата

Это был день охоты за сокровищами — красивое лесное приключение.

Ознакомьтесь с другими нашими походами по охоте за грибами:

Могучие охотники за грибами (и некоторые рецепты гигантских шариков)

Сбор грибов Мореля в хижине

Больше грибов: суп из дикого риса и сморчков

Охота за грибами: паста с грибами сморчков в нежном сливочном соусе

* * * * *

Кухня Frau Примечания: Используйте оставшийся вареный черный или коричневый рис или приготовьте немного специально для супа.Налейте стакана черного риса + ½ стакана воды в небольшую кастрюлю. Доведите до кипения, перемешайте, затем убавьте огонь до минимума, накройте крышкой и тушите 25 минут (40 минут для коричневого риса). Черный рис со временем выщелачивает суп, и если вы повторно нагреете остатки на следующий день, бульон потемнеет, а кубики яиц станут пурпурными по сравнению с цветом риса (безвредны), поэтому, если вы предпочитаете свои яичные кубики оставаться светло-желтым, я предлагаю добавить приготовленный черный рис в суп непосредственно перед подачей на стол. Если вы используете коричневый рис, этого не произойдет, но потрясающий цвет черного риса станет прекрасным контрастом супу.

Используйте ароматный домашний куриный бульон для этого супа или концентрат хорошего качества (мне нравится паста-концентрат Better Than Bouillon ).

Суп из коралловых грибов и яиц
  • 6 чашек (1,5 л) ароматного куриного бульона, домашнего приготовления или из высококачественного концентрата
  • Очищенный кусок имбиря, 1 дюйм (2,5 см)
  • 1 столовая ложка рыбного соуса
  • 1 столовая ложка соевого соуса тамари
  • ¼ чайная ложка соуса из острого перца шрирача
  • 1 чайная ложка сливочного масла
  • 4 крупных яйца
  • ¼ чайная ложка соли
  • ¼ чайная ложка мускатного ореха
  • 1 чашка (или большая горсть) коралловых грибов, очищенных и промытых, или замените их другими дикими грибами или тонко нарезанными шампиньонами, или используйте осушенные коралловые грибы, которые вы сохранили в соответствии с рецептом ниже
  • 1 пучок зеленого лука / зеленого лука (от 6 до 8 луковиц)
  • ¾ чашки (180 мл) вареного черного риса * см. Примечания выше (или остатки коричневого риса)
  • 2 чайные ложки обжаренного кунжутного масла

Вылейте куриный бульон в большую кастрюлю.Нарежьте очищенный имбирь тонкими ломтиками, сложите ломтики и нарежьте их тонкими ломтиками. Добавьте кусочки имбиря, рыбный соус, тамари и шрирача в куриный бульон и доведите его до кипения. Уменьшите огонь, накройте кастрюлю крышкой и тушите бульон 10 минут.

Пока бульон кипит, растопите масло в 9-дюймовой сковороде с антипригарным покрытием на среднем или слабом огне. Взбить яйца с солью и мускатным орехом и вылить в сковороду. Дайте яйцам вариться, не помешивая, пока дно не застынет, но не подрумянится.Осторожно переверните яичный блин, чтобы приготовить другую сторону (но не позволяйте ему подрумяниться) или, если ваша сковорода безопасна для использования в духовке, вы можете приготовить верх, поставив сковороду в духовку на предварительно разогретую жаровню на пару минут. — только до тех пор, пока не будет установлен верх. Выложите яичный блин на разделочную доску и разрежьте на квадраты размером ½ дюйма (1 см). Отложите их в сторону.

В кипящий бульон добавить коралловые грибы и зеленый лук. Доведите суп до кипения, затем убавьте огонь и тушите 1 минуту. Добавьте кубики яиц, приготовленный черный рис и кунжутное масло.Снимите суп с огня и сразу подавайте.

На 4 порции (или на 6 легких первых блюд).

* * * * *

Консервированные слегка маринованные коралловые грибы

Консервы из этих нежных грибов для использования в супах и рецептах.

  • 4 чашки (300 г) коралловых грибов (слегка упакованные), очищенные
  • 1 стакан (240 мл) воды
  • ¼ чашки (60 мл) белого уксуса
  • ½ чайной ложки мелкой морской соли
  • 2 очищенных и слегка измельченных зубчика чеснока
  • 2 веточки свежего тимьяна
  • 12 целых горошин перца
  • 2 банки для консервирования по полпинты (250 мл)

Перед началом убедитесь, что коралловые грибы хорошо очищены: промойте их несколько раз в смене чистой воды, чтобы удалить небольшие кусочки лесного мусора, застрявшие между прядями.Обрежьте все коричневые кусочки или корни в нижней части гроздей, затем хорошо слейте их, выложите одним слоем на чистое кухонное полотенце и накройте другим кухонным полотенцем. Осторожно нажмите, чтобы удалить лишнюю воду. Чтобы убедиться, что они действительно высохли, разложите грибы на другом сухом полотенце и сверните их, затем оставьте в холодильнике примерно на час, чтобы полотенце впитало влагу.

Стерилизуйте банки для консервирования, кипятя их в воде в течение 5 минут. Нагрейте металлические крышки с защелками в кипящей воде.

Нагрейте воду, уксус и соль до кипения в небольшой кастрюле. Добавьте коралловые грибы и снова доведите рассол до кипения. Грибы сильно уменьшатся в размерах. Снимите кастрюлю с огня.

Выньте горячие банки из кипящей воды, слейте воду и на дно каждой положите 1 зубчик чеснока, 6 горошин перца и веточку свежего тимьяна.

Вычерпайте горячие грибы из рассола шумовкой и равномерно разделите их между двумя банками. Вылейте оставшийся рассол на грибы в банках, пока они не будут заполнены на ½ дюйма от верха.Протрите края банок начисто, наденьте металлические крышки с защелками и завинтите ленты, закрыв их только от руки.

Выстелите чистое кухонное полотенце в большой кастрюле, которая как минимум на 2 дюйма выше фляг. Поставьте банки в кастрюлю, не касаясь друг друга, на кухонное полотенце (чтобы они не подпрыгивали при закипании воды). Наполните кастрюлю горячей водой, чтобы накрыть банки.

Доведите до кипения, затем немного убавьте огонь, чтобы вода оставалась на среднем уровне кипения. Накройте кастрюлю крышкой и дайте банкам закипеть 10 минут.Выложите их на кухонное полотенце на столе, чтобы они остыли. Когда они остынут и вы увидите, что крышки присосались к банкам (вы должны были услышать хлопок, когда они закрылись, и крышка не должна изгибаться вверх), банки можно хранить в прохладном месте до 1 часа. год. Если банка не закрывается, храните ее в холодильнике и используйте в течение 2 недель.

Используйте в качестве гарнира или в супах, тушеных блюдах или во фритюре (добавляйте ближе к концу времени приготовления).

На 2 полпинты.

* * * * *

Обжаренные коралловые грибы Hericium для супового гарнира или омлета
  • 2 столовые ложки сливочного масла
  • 1 нарезанный лук-шалот
  • листьев с 1 веточки тимьяна
  • 1 чашка (большая горсть) очищенных и крупно нарезанных коралловых грибов Hericium
  • щепотка соли

Убедитесь, что коралловый гриб Hericium хорошо очищен и ополоснут.

Растопите масло в сковороде на среднем огне. Добавьте лук-шалот и листья тимьяна и готовьте 2–3 минуты, пока не станет мягким. Добавьте нарезанные коралловые грибы и соль и готовьте еще 2–3 минуты, пока гриб не станет мягким.

Подавать в качестве гарнира к крем-супам (вкус грибов / морепродуктов дополняет многие разновидности крем-супов), к тостам, омлетам, пасте или яичнице-болтунье.

На 4 порции в качестве гарнира.

* * * * *

Приятного аппетита!

Хотите, чтобы номер получал новые рецепты кухни Frau прямо на вашу электронную почту? Зарегистрируйтесь здесь, и вы получите полезные советы по приготовлению пищи вместе с каждым рецептом.(Никакого спама).

Если вам нравятся мои рецепты, подписывайтесь на меня в Instagram, Pinterest, Twitter и Facebook. Ты сделаешь мой день лучше!

PIN ЭТО ЗДЕСЬ, чтобы сохранить рецепт на потом:

Возможно вам понравится:

Стейк и грибы — классический

Грибы на тосте

Шницель из слоеного шарика с шалфеем и луковой подливкой

Теплые кусочки слоеного шарика с мисо и тыквенными семечками

Экстрактов грибного мицелия полипор, уменьшающих количество вирусов у медоносных пчел

Приготовление экстрактов грибного мицелия

Пол Стаметс собрал и культивировал следующие виды / штаммы мицелия: , Duckabush Valley, Вашингтон,

Trametes versicolor , Kamilche Point, Вашингтон

Культура Ganoderma resicolor была получена из анонимного источника в Онтарио, Канада.

Мицелиальные культуры выращивали в стерильных чашках Петри, содержащих стерилизованный агар с солодовыми дрожжами (Fungi Perfecti, Shelton, WA). После трех-четырех недель колонизации в лаборатории с чистым помещением культуры в асептических условиях переносили в мешалку Eberbach на 1000 мл, содержащую 800 мл стерилизованной воды. Мицелий фрагментировали в контейнере Eberbach с использованием базы блендера Waring. Затем мицелиальный бульон разбавляли 1:10 стерильной водой и переносили в стерильных условиях в полипропиленовые мешки для инкубации, содержащие приблизительно 3 кг стерилизованного коричневого риса, содержание влаги в котором доводили до приблизительно 45% перед стерилизацией.Аликвоту 50–100 мл разбавленной жидкости переносили в каждый из 3 кг стерилизованных пакетов для риса в стерильных условиях. Затем свежие мицелиальные культуры инкубировали в течение 30–60 дней, в зависимости от вида, в чистой комнате, контролируемой HEPA. Затем каждый мешок с микоферментированным рисом распределяли по 20 полипропиленовым мешкам из стерилизованных березовых опилок ( Betula papyrifera ) (по 2 кг каждый) и инкубировали в течение 30–60 дней в зависимости от вида.

После того, как колонизация была определена как достаточная (см. Дополнительный рис.S1) субстрат, колонизированный мицелием, замораживали для остановки роста, затем переносили в контейнеры из полиэтилена высокой плотности для экстракции. Мицелированный субстрат смешивали с 50% -ным раствором этанола / воды (приготовленным путем смешивания равных масс 95% -ного органического этилового спирта и родниковой воды), вдвое превышающего массу мицелированного субстрата, перемешивали, а затем мацерировали при комнатной температуре в течение 3-5 дней. дней. Смесь фильтровали под давлением и супернатант декантировали в контейнеры для хранения при 4 ° C. Конечный продукт содержит этанол, соединения мицелия грибов и, возможно, неиспользованные компоненты субстрата для роста.Все экстракты были приготовлены в соответствии со стандартизированным производственным процессом и использовались в последующих тестах в качестве сырых экстрактов ферментации твердого субстрата без дополнительной очистки или определения характеристик.

Обработка клеток и полей экстрактом грибов

Для клеточных исследований большая популяционная клетка была заполнена примерно 10 кг рабочих медоносных пчел, собранных из нескольких колоний, проживающих на одной пасеке в Пуллмане, Вашингтон, США. Каждая экспериментальная клетка (n = 5 на обработку) была заселена примерно 300 рабочими пчелами из каждой клетки и содержалась в лаборатории с ad libitum источниками воды и 1: 1 сиропом сахароза / вода в / в или экстрактами мицелия ( 1%, 0.1% или 0,01% об. / Об. В сиропе сахароза / вода 1: 1). Образцы 50 пчел собирали из каждой повторной клетки / обработки на 7 день и замораживали до анализа титра вируса. Клетки, в которых погибло 50% или более особей в ходе эксперимента, не использовались для последующих анализов. Было проведено три испытания, и у отдельных пчел были взяты пробы из популяционной клетки во втором испытании клетки, чтобы установить индивидуальные уровни вируса на фиг. 2А.

Для полевых исследований в сентябре 2016 года недалеко от Москвы, штат Айдахо, были созданы 30 пятикамерных «ядерных» колоний, каждая с маткой-несушкой и примерно 8000 рабочих пчел.Для создания колоний с уравновешенными исходными вирусными уровнями приблизительно 30 кг рабочих медоносных пчел были собраны из нескольких колоний, проживающих на экспериментальных пасеках Вашингтонского государственного университета (Пуллман, Вашингтон), и помещены в большую клетку для популяций. Для хранения колоний ядра приблизительно 1 кг взрослых рабочих пчел был извлечен из объединенной клетки для популяций и добавлен в каждую экспериментальную колонию. Колонии ядер содержались снаружи и позволяли свободный полет и нормальный поиск пищи на протяжении всего эксперимента.Перед обработкой отбирали образцы всех колоний для определения исходного уровня вируса и снова через 12 дней после обработки. Каждой из десяти репликативных колоний вводили экстракты мицелия F. fomentarius или G. resinaaceum в концентрации 0,01 (1% экстракт) в 3 литрах сиропа сахароза / вода 1: 1 (экстракты) или вводили сахарозу 1: 1. только сироп (контроль).

Вирусы — обработка образцов, q-ПЦР и статистический анализ

Для анализа уровней вируса в клетке или колонии ядра 50 мл пчел (~ 60–100 особей) собирали на сухой лед и затем хранили при -80 ° С.Затем из каждого образца собирали 50 пчел для молекулярного анализа. Пчел гомогенизировали в одноразовом пакете для экстракции РНК с 20 мл буфера для лизиса тиоцианата гуанидина (GITC), и нуклеиновые кислоты экстрагировали с использованием протокола кислотного фенола 39 . Нуклеиновые кислоты обрабатывали ДНКазой I при 37 ° C в течение 1 ч, а затем 10 мин при 75 ° C. Комплементарную ДНК первой цепи (кДНК) получали из 2 мкг общей РНК с использованием мастер-смеси, содержащей 50 U Superscript II (Invitrogen), набор случайных праймеров (7-мерный при концентрации 10 мМ), смесь dNTP 2 нмоль, polydT 2 нмоль -18 и 0.1 нмоль polydT (12–18). Синтез кДНК проводили при 42 ° C в течение 50 минут, а затем 15 минут при 70 ° C 37 . Образцы были проверены на вирусы медоносных пчел с помощью количественной ПЦР в реальном времени (1 мкл матрицы кДНК в 20 мкл реакции) с использованием Bio-Rad SsoFast ™ SYBR® Green Supermix, 96-луночных оптических планшетов для ПЦР и Bio-Rad CFX Connect ™. термоциклер. Положительные контроли (очищенный продукт ПЦР) и нематричные контроли (свободный от нуклеаз h3O) включали в каждый цикл. Термоциклер был запрограммирован на активацию фермента при 95 ° C в течение 30 секунд с последующими 50 циклами денатурации при 95 ° C в течение 5 секунд и отжига / удлинения при 60 ° C в течение 30 секунд.

Последовательности праймеров, используемые для КПЦР, перечислены ниже. Последовательности праймеров DWV и RpS5 взяты из Englesdorp et al . 38 , а последовательность для LSV получена от R. Cornman из USDA-ARS (неопубликованные данные). И DWV, и LSV праймеры предназначены для нацеливания на участки генетической консервации вирусов, что позволяет обнаруживать большинство генотипов.

A.mel- RpS5.F: AATTATTTGGTCGCTGGAATTG

A.mel- RpS5.R: TAACGTCCAGCAGAATGTGGTA

DWV.F: GAGATTGAAGCGCATGAACA

DWV.R: TGAATTCAGTGTCGCCCATA

LSVF: GTCATCCCAAGAGAACCACTYAC

LSVR: CRCACYGACATGAAGAAATGAGGTC

для экспрессии вируса с нормальным уровнем экспрессии 9095, эталонный уровень ∆Ct вируса 9095 был определен с использованием эталонного метода 9095 для экспрессии вируса 9099, эталонный уровень 9099 ∆p99. Статистические данные и стандартные ошибки были рассчитаны с использованием этих значений ∆Ct (которые основаны на log 2 ). Затем было рассчитано изменение складки с использованием метода ∆∆Ct 38 .Для испытаний в клетках ∆∆Ct рассчитывали путем прямого сравнения лечебных и контрольных клеток. Для полевых испытаний, в которых был установлен исходный уровень вируса, рассчитывали ∆∆Ct в каждой группе лечения или контрольной группе, и сравнения проводили путем деления обработки ∆∆Ct на контрольную ∆∆Ct. Для графического представления на рисунках 1 и 2 значения ∆Ct были нормализованы к средним вирусным значениям для контрольных колоний в этом испытании. Образцы, для которых эталонный ген RpS5 не амплифицировался на 40 Cts, были удалены.Поскольку некоторые ульи уничтожили вирус до уровней обнаружения ниже qPCR, значение Ct = 51 было присвоено любому образцу, где вирус не был обнаружен к концу запуска qPCR при Ct = 50. t-тесты Стьюдента были выполнены с использованием 2- хвосты и неравная дисперсия в RStudio (RStudio Inc., Бостон, Массачусетс, США).

Секвенирование

Поскольку эндофиты являются обычным явлением на зрелых деревьях, мы проверили неинокулированные березовые опилки на наличие эндогенных грибов, используя секвенирование следующего поколения. Эти опилки использовались для изготовления экстрактов древесины березы и служили конечным субстратом для роста грибков гниения древесины, используемых для приготовления экстрактов грибов.Компания Authentechnologies (Ричмонд, Калифорния) использовала запатентованные универсальные праймеры для грибов для амплификации 11460 считываний, секвенированных с помощью секвенсора ДНК нового поколения Ion Torrent Personal Genome Machine.

Неожиданное волшебство грибов

Но у грибов есть применение, которое позволяет решать другие проблемы, выходящие за рамки нашего здоровья.

Грибок, обнаруженный в почве на свалке на окраине Исламабада, Пакистан, может быть решением проблемы тревожного уровня пластикового загрязнения, засоряющего наши океаны.Фариха Хасан, микробиолог из Университета Куэйд-И-Азам в Исламабаде, обнаружила, что грибок Aspergillus tubingensis может быстро разрушать полиуретановый пластик.

Эти пластмассы, которые использовались для изготовления широкого спектра продуктов, включая пену для мебели, корпуса для электроники, клеи и пленки, могут годами оставаться в почве и морской воде. Однако было обнаружено, что грибы разрушают его в течение нескольких недель. Хасан и ее команда сейчас исследуют, как использовать грибы для крупномасштабного разложения пластиковых отходов.Другие грибы, такие как Pestalotiopsis microspore , которые обычно растут на гниющих листьях плюща, также обладают огромным аппетитом к пластику, что вселяет надежду на то, что их можно использовать для решения нашей растущей проблемы отходов.

На самом деле, грибы очень любят загрязнения, которыми мы загрязняем наш мир. Были обнаружены виды, которые могут очищать почву от загрязнения нефтью, разлагать вредные тяжелые металлы, потреблять стойкие пестициды и даже помогать восстанавливать радиоактивные объекты.

Грибы, однако, также могут помочь избежать необходимости в использовании некоторых пластмасс.

Ряд групп по всему миру в настоящее время пытаются использовать ключевую особенность грибов — прожилковидную сеть мицелия, которую они производят, — для создания материалов, которые могут заменить пластиковую упаковку. По мере роста грибов эти нити мицелия разветвляются наружу, проникая в укромные уголки и трещины в почве, связывая ее вместе. Это клей природы.

В 2010 году компания Ecovative Design начала изучать, как они могут использовать это для связывания природных отходов, таких как рисовая шелуха или древесная стружка, для производства альтернативы упаковке из полистирола.Их ранние работы переросли в MycoComposite, в котором в качестве основного материала используются оставшиеся кусочки конопли.

Их упаковывают в формы многоразового использования вместе со спорами грибов и мукой, которые затем оставляют для роста в течение девяти дней. При этом они производят ферменты, которые начинают переваривать отходы.

232 thoughts on “Опята очистка: Как быстро почистить опята разных видов

  1. kamagraa.space

    I am extremely impressed along with your writing skills as
    well as with the layout for your weblog. Is this a paid
    topic or did you modify it yourself? Either way stay up the nice high
    quality writing, it is uncommon to see a great weblog like this
    one these days..

    my web-site: kamagraa.space

  2. fc2.com

    I was more than happy to uncover this web site. I need to to thank
    you for your time just for this wonderful read!! I definitely enjoyed every part of
    it and i also have you book marked to look at new things in your site.

  3. kamagra2023.quest

    Oh my goodness! Incredible article dude! Thanks, However I am going hrough problems with your RSS.
    I don’t know tthe reason why I can’t join it.

    Is there anybody else having similar RSS issues?
    Anybody who knows the solution can you kindly respond?
    Thanks!!

    My homepage … kamagra2023.quest

  4. kamagra 160 mg prezzo

    Have you ever considered about including a little bit more than just your articles?
    I mean, what you say is fundamental and everything. However think
    of if you added some great images or videos to give your posts more,
    «pop»! Your content is excellent but with pics and videos, this blog could undeniably be one of the greatest in its field.
    Very good blog!

    Here is mmy blog post :: kamagra 160 mg prezzo

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *